Compare commits
33 Commits
sidenotes
...
153349f3d5
| Author | SHA1 | Date | |
|---|---|---|---|
| 153349f3d5 | |||
| 8d22acfe78 | |||
| c1b030ee97 | |||
| 803f52b2d0 | |||
| 2f96abeef6 | |||
| 163fcd2b2e | |||
| 9ddcb1b3f2 | |||
| 133979218a | |||
| ef545be03c | |||
| c534dc7508 | |||
| 263ffe2b8c | |||
| 67181fb033 | |||
| a026e67a3b | |||
| d9544398b9 | |||
| 1c4bb29fdd | |||
| 765d497724 | |||
| 80410c9200 | |||
| 4e918db5cb | |||
| 382102f071 | |||
| 6e88780f8b | |||
| e3035b9d66 | |||
| 8765626898 | |||
| c38247df9e | |||
| baf44f8627 | |||
| 19aa126025 | |||
| a406fb0846 | |||
| 75664e90bb | |||
| f74209c970 | |||
| c7ce8a3107 | |||
| b3b906dd90 | |||
| b8e0e0b4ce | |||
| eb02e1e6b0 | |||
| b2fc6ea5a8 |
@@ -6,7 +6,7 @@
|
|||||||
}
|
}
|
||||||
|
|
||||||
.gmachine-instruction-name {
|
.gmachine-instruction-name {
|
||||||
padding: 10px;
|
padding: .8rem;
|
||||||
border-right: $standard-border;
|
border-right: $standard-border;
|
||||||
flex-grow: 1;
|
flex-grow: 1;
|
||||||
flex-basis: 20%;
|
flex-basis: 20%;
|
||||||
@@ -28,12 +28,12 @@
|
|||||||
}
|
}
|
||||||
|
|
||||||
.gmachine-inner-label {
|
.gmachine-inner-label {
|
||||||
padding: 10px;
|
padding: .8rem;
|
||||||
font-weight: bold;
|
font-weight: bold;
|
||||||
}
|
}
|
||||||
|
|
||||||
.gmachine-inner-text {
|
.gmachine-inner-text {
|
||||||
padding: 10px;
|
padding: .8rem;
|
||||||
text-align: right;
|
text-align: right;
|
||||||
flex-grow: 1;
|
flex-grow: 1;
|
||||||
}
|
}
|
||||||
|
|||||||
42
code/compiler/09/CMakeLists.txt
Normal file
42
code/compiler/09/CMakeLists.txt
Normal file
@@ -0,0 +1,42 @@
|
|||||||
|
cmake_minimum_required(VERSION 3.1)
|
||||||
|
project(compiler)
|
||||||
|
|
||||||
|
# Find all the required packages
|
||||||
|
find_package(BISON)
|
||||||
|
find_package(FLEX)
|
||||||
|
find_package(LLVM REQUIRED CONFIG)
|
||||||
|
|
||||||
|
# Set up the flex and bison targets
|
||||||
|
bison_target(parser
|
||||||
|
${CMAKE_CURRENT_SOURCE_DIR}/parser.y
|
||||||
|
${CMAKE_CURRENT_BINARY_DIR}/parser.cpp
|
||||||
|
COMPILE_FLAGS "-d")
|
||||||
|
flex_target(scanner
|
||||||
|
${CMAKE_CURRENT_SOURCE_DIR}/scanner.l
|
||||||
|
${CMAKE_CURRENT_BINARY_DIR}/scanner.cpp)
|
||||||
|
add_flex_bison_dependency(scanner parser)
|
||||||
|
|
||||||
|
# Find all the relevant LLVM components
|
||||||
|
llvm_map_components_to_libnames(LLVM_LIBS core x86asmparser x86codegen)
|
||||||
|
|
||||||
|
# Create compiler executable
|
||||||
|
add_executable(compiler
|
||||||
|
ast.cpp ast.hpp definition.cpp
|
||||||
|
llvm_context.cpp llvm_context.hpp
|
||||||
|
type_env.cpp type_env.hpp
|
||||||
|
env.cpp env.hpp
|
||||||
|
type.cpp type.hpp
|
||||||
|
error.cpp error.hpp
|
||||||
|
binop.cpp binop.hpp
|
||||||
|
instruction.cpp instruction.hpp
|
||||||
|
${BISON_parser_OUTPUTS}
|
||||||
|
${FLEX_scanner_OUTPUTS}
|
||||||
|
main.cpp
|
||||||
|
)
|
||||||
|
|
||||||
|
# Configure compiler executable
|
||||||
|
target_include_directories(compiler PUBLIC ${CMAKE_CURRENT_SOURCE_DIR})
|
||||||
|
target_include_directories(compiler PUBLIC ${CMAKE_CURRENT_BINARY_DIR})
|
||||||
|
target_include_directories(compiler PUBLIC ${LLVM_INCLUDE_DIRS})
|
||||||
|
target_compile_definitions(compiler PUBLIC ${LLVM_DEFINITIONS})
|
||||||
|
target_link_libraries(compiler ${LLVM_LIBS})
|
||||||
264
code/compiler/09/ast.cpp
Normal file
264
code/compiler/09/ast.cpp
Normal file
@@ -0,0 +1,264 @@
|
|||||||
|
#include "ast.hpp"
|
||||||
|
#include <ostream>
|
||||||
|
#include "binop.hpp"
|
||||||
|
#include "error.hpp"
|
||||||
|
|
||||||
|
static void print_indent(int n, std::ostream& to) {
|
||||||
|
while(n--) to << " ";
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr ast::typecheck_common(type_mgr& mgr, const type_env& env) {
|
||||||
|
node_type = typecheck(mgr, env);
|
||||||
|
return node_type;
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast::resolve_common(const type_mgr& mgr) {
|
||||||
|
type_var* var;
|
||||||
|
type_ptr resolved_type = mgr.resolve(node_type, var);
|
||||||
|
if(var) throw type_error("ambiguously typed program");
|
||||||
|
|
||||||
|
resolve(mgr);
|
||||||
|
node_type = std::move(resolved_type);
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_int::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "INT: " << value << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr ast_int::typecheck(type_mgr& mgr, const type_env& env) const {
|
||||||
|
return type_ptr(new type_base("Int"));
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_int::resolve(const type_mgr& mgr) const {
|
||||||
|
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_int::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
|
||||||
|
into.push_back(instruction_ptr(new instruction_pushint(value)));
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_lid::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "LID: " << id << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr ast_lid::typecheck(type_mgr& mgr, const type_env& env) const {
|
||||||
|
return env.lookup(id);
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_lid::resolve(const type_mgr& mgr) const {
|
||||||
|
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_lid::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
|
||||||
|
into.push_back(instruction_ptr(
|
||||||
|
env->has_variable(id) ?
|
||||||
|
(instruction*) new instruction_push(env->get_offset(id)) :
|
||||||
|
(instruction*) new instruction_pushglobal(id)));
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_uid::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "UID: " << id << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr ast_uid::typecheck(type_mgr& mgr, const type_env& env) const {
|
||||||
|
return env.lookup(id);
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_uid::resolve(const type_mgr& mgr) const {
|
||||||
|
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_uid::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
|
||||||
|
into.push_back(instruction_ptr(new instruction_pushglobal(id)));
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_binop::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "BINOP: " << op_name(op) << std::endl;
|
||||||
|
left->print(indent + 1, to);
|
||||||
|
right->print(indent + 1, to);
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr ast_binop::typecheck(type_mgr& mgr, const type_env& env) const {
|
||||||
|
type_ptr ltype = left->typecheck_common(mgr, env);
|
||||||
|
type_ptr rtype = right->typecheck_common(mgr, env);
|
||||||
|
type_ptr ftype = env.lookup(op_name(op));
|
||||||
|
if(!ftype) throw type_error(std::string("unknown binary operator ") + op_name(op));
|
||||||
|
|
||||||
|
type_ptr return_type = mgr.new_type();
|
||||||
|
type_ptr arrow_one = type_ptr(new type_arr(rtype, return_type));
|
||||||
|
type_ptr arrow_two = type_ptr(new type_arr(ltype, arrow_one));
|
||||||
|
|
||||||
|
mgr.unify(arrow_two, ftype);
|
||||||
|
return return_type;
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_binop::resolve(const type_mgr& mgr) const {
|
||||||
|
left->resolve_common(mgr);
|
||||||
|
right->resolve_common(mgr);
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_binop::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
|
||||||
|
right->compile(env, into);
|
||||||
|
left->compile(env_ptr(new env_offset(1, env)), into);
|
||||||
|
|
||||||
|
into.push_back(instruction_ptr(new instruction_pushglobal(op_action(op))));
|
||||||
|
into.push_back(instruction_ptr(new instruction_mkapp()));
|
||||||
|
into.push_back(instruction_ptr(new instruction_mkapp()));
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_app::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "APP:" << std::endl;
|
||||||
|
left->print(indent + 1, to);
|
||||||
|
right->print(indent + 1, to);
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr ast_app::typecheck(type_mgr& mgr, const type_env& env) const {
|
||||||
|
type_ptr ltype = left->typecheck_common(mgr, env);
|
||||||
|
type_ptr rtype = right->typecheck_common(mgr, env);
|
||||||
|
|
||||||
|
type_ptr return_type = mgr.new_type();
|
||||||
|
type_ptr arrow = type_ptr(new type_arr(rtype, return_type));
|
||||||
|
mgr.unify(arrow, ltype);
|
||||||
|
return return_type;
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_app::resolve(const type_mgr& mgr) const {
|
||||||
|
left->resolve_common(mgr);
|
||||||
|
right->resolve_common(mgr);
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_app::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
|
||||||
|
right->compile(env, into);
|
||||||
|
left->compile(env_ptr(new env_offset(1, env)), into);
|
||||||
|
into.push_back(instruction_ptr(new instruction_mkapp()));
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_case::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "CASE: " << std::endl;
|
||||||
|
for(auto& branch : branches) {
|
||||||
|
print_indent(indent + 1, to);
|
||||||
|
branch->pat->print(to);
|
||||||
|
to << std::endl;
|
||||||
|
branch->expr->print(indent + 2, to);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr ast_case::typecheck(type_mgr& mgr, const type_env& env) const {
|
||||||
|
type_var* var;
|
||||||
|
type_ptr case_type = mgr.resolve(of->typecheck_common(mgr, env), var);
|
||||||
|
type_ptr branch_type = mgr.new_type();
|
||||||
|
|
||||||
|
for(auto& branch : branches) {
|
||||||
|
type_env new_env = env.scope();
|
||||||
|
branch->pat->match(case_type, mgr, new_env);
|
||||||
|
type_ptr curr_branch_type = branch->expr->typecheck_common(mgr, new_env);
|
||||||
|
mgr.unify(branch_type, curr_branch_type);
|
||||||
|
}
|
||||||
|
|
||||||
|
case_type = mgr.resolve(case_type, var);
|
||||||
|
if(!dynamic_cast<type_data*>(case_type.get())) {
|
||||||
|
throw type_error("attempting case analysis of non-data type");
|
||||||
|
}
|
||||||
|
|
||||||
|
return branch_type;
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_case::resolve(const type_mgr& mgr) const {
|
||||||
|
of->resolve_common(mgr);
|
||||||
|
for(auto& branch : branches) {
|
||||||
|
branch->expr->resolve_common(mgr);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void ast_case::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
|
||||||
|
type_data* type = dynamic_cast<type_data*>(of->node_type.get());
|
||||||
|
|
||||||
|
of->compile(env, into);
|
||||||
|
into.push_back(instruction_ptr(new instruction_eval()));
|
||||||
|
|
||||||
|
instruction_jump* jump_instruction = new instruction_jump();
|
||||||
|
into.push_back(instruction_ptr(jump_instruction));
|
||||||
|
for(auto& branch : branches) {
|
||||||
|
std::vector<instruction_ptr> branch_instructions;
|
||||||
|
pattern_var* vpat;
|
||||||
|
pattern_constr* cpat;
|
||||||
|
|
||||||
|
if((vpat = dynamic_cast<pattern_var*>(branch->pat.get()))) {
|
||||||
|
branch->expr->compile(env_ptr(new env_offset(1, env)), branch_instructions);
|
||||||
|
|
||||||
|
for(auto& constr_pair : type->constructors) {
|
||||||
|
if(jump_instruction->tag_mappings.find(constr_pair.second.tag) !=
|
||||||
|
jump_instruction->tag_mappings.end())
|
||||||
|
break;
|
||||||
|
|
||||||
|
jump_instruction->tag_mappings[constr_pair.second.tag] =
|
||||||
|
jump_instruction->branches.size();
|
||||||
|
}
|
||||||
|
jump_instruction->branches.push_back(std::move(branch_instructions));
|
||||||
|
} else if((cpat = dynamic_cast<pattern_constr*>(branch->pat.get()))) {
|
||||||
|
env_ptr new_env = env;
|
||||||
|
for(auto it = cpat->params.rbegin(); it != cpat->params.rend(); it++) {
|
||||||
|
new_env = env_ptr(new env_var(*it, new_env));
|
||||||
|
}
|
||||||
|
|
||||||
|
branch_instructions.push_back(instruction_ptr(new instruction_split(
|
||||||
|
cpat->params.size())));
|
||||||
|
branch->expr->compile(new_env, branch_instructions);
|
||||||
|
branch_instructions.push_back(instruction_ptr(new instruction_slide(
|
||||||
|
cpat->params.size())));
|
||||||
|
|
||||||
|
int new_tag = type->constructors[cpat->constr].tag;
|
||||||
|
if(jump_instruction->tag_mappings.find(new_tag) !=
|
||||||
|
jump_instruction->tag_mappings.end())
|
||||||
|
throw type_error("technically not a type error: duplicate pattern");
|
||||||
|
|
||||||
|
jump_instruction->tag_mappings[new_tag] =
|
||||||
|
jump_instruction->branches.size();
|
||||||
|
jump_instruction->branches.push_back(std::move(branch_instructions));
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
for(auto& constr_pair : type->constructors) {
|
||||||
|
if(jump_instruction->tag_mappings.find(constr_pair.second.tag) ==
|
||||||
|
jump_instruction->tag_mappings.end())
|
||||||
|
throw type_error("non-total pattern");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void pattern_var::print(std::ostream& to) const {
|
||||||
|
to << var;
|
||||||
|
}
|
||||||
|
|
||||||
|
void pattern_var::match(type_ptr t, type_mgr& mgr, type_env& env) const {
|
||||||
|
env.bind(var, t);
|
||||||
|
}
|
||||||
|
|
||||||
|
void pattern_constr::print(std::ostream& to) const {
|
||||||
|
to << constr;
|
||||||
|
for(auto& param : params) {
|
||||||
|
to << " " << param;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void pattern_constr::match(type_ptr t, type_mgr& mgr, type_env& env) const {
|
||||||
|
type_ptr constructor_type = env.lookup(constr);
|
||||||
|
if(!constructor_type) {
|
||||||
|
throw type_error(std::string("pattern using unknown constructor ") + constr);
|
||||||
|
}
|
||||||
|
|
||||||
|
for(int i = 0; i < params.size(); i++) {
|
||||||
|
type_arr* arr = dynamic_cast<type_arr*>(constructor_type.get());
|
||||||
|
if(!arr) throw type_error("too many parameters in constructor pattern");
|
||||||
|
|
||||||
|
env.bind(params[i], arr->left);
|
||||||
|
constructor_type = arr->right;
|
||||||
|
}
|
||||||
|
|
||||||
|
mgr.unify(t, constructor_type);
|
||||||
|
}
|
||||||
141
code/compiler/09/ast.hpp
Normal file
141
code/compiler/09/ast.hpp
Normal file
@@ -0,0 +1,141 @@
|
|||||||
|
#pragma once
|
||||||
|
#include <memory>
|
||||||
|
#include <vector>
|
||||||
|
#include "type.hpp"
|
||||||
|
#include "type_env.hpp"
|
||||||
|
#include "binop.hpp"
|
||||||
|
#include "instruction.hpp"
|
||||||
|
#include "env.hpp"
|
||||||
|
|
||||||
|
struct ast {
|
||||||
|
type_ptr node_type;
|
||||||
|
|
||||||
|
virtual ~ast() = default;
|
||||||
|
|
||||||
|
virtual void print(int indent, std::ostream& to) const = 0;
|
||||||
|
virtual type_ptr typecheck(type_mgr& mgr, const type_env& env) const = 0;
|
||||||
|
virtual void resolve(const type_mgr& mgr) const = 0;
|
||||||
|
virtual void compile(const env_ptr& env,
|
||||||
|
std::vector<instruction_ptr>& into) const = 0;
|
||||||
|
|
||||||
|
type_ptr typecheck_common(type_mgr& mgr, const type_env& env);
|
||||||
|
void resolve_common(const type_mgr& mgr);
|
||||||
|
};
|
||||||
|
|
||||||
|
using ast_ptr = std::unique_ptr<ast>;
|
||||||
|
|
||||||
|
struct pattern {
|
||||||
|
virtual ~pattern() = default;
|
||||||
|
|
||||||
|
virtual void print(std::ostream& to) const = 0;
|
||||||
|
virtual void match(type_ptr t, type_mgr& mgr, type_env& env) const = 0;
|
||||||
|
};
|
||||||
|
|
||||||
|
using pattern_ptr = std::unique_ptr<pattern>;
|
||||||
|
|
||||||
|
struct branch {
|
||||||
|
pattern_ptr pat;
|
||||||
|
ast_ptr expr;
|
||||||
|
|
||||||
|
branch(pattern_ptr p, ast_ptr a)
|
||||||
|
: pat(std::move(p)), expr(std::move(a)) {}
|
||||||
|
};
|
||||||
|
|
||||||
|
using branch_ptr = std::unique_ptr<branch>;
|
||||||
|
|
||||||
|
struct ast_int : public ast {
|
||||||
|
int value;
|
||||||
|
|
||||||
|
explicit ast_int(int v)
|
||||||
|
: value(v) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
|
||||||
|
void resolve(const type_mgr& mgr) const;
|
||||||
|
void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct ast_lid : public ast {
|
||||||
|
std::string id;
|
||||||
|
|
||||||
|
explicit ast_lid(std::string i)
|
||||||
|
: id(std::move(i)) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
|
||||||
|
void resolve(const type_mgr& mgr) const;
|
||||||
|
void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct ast_uid : public ast {
|
||||||
|
std::string id;
|
||||||
|
|
||||||
|
explicit ast_uid(std::string i)
|
||||||
|
: id(std::move(i)) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
|
||||||
|
void resolve(const type_mgr& mgr) const;
|
||||||
|
void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct ast_binop : public ast {
|
||||||
|
binop op;
|
||||||
|
ast_ptr left;
|
||||||
|
ast_ptr right;
|
||||||
|
|
||||||
|
ast_binop(binop o, ast_ptr l, ast_ptr r)
|
||||||
|
: op(o), left(std::move(l)), right(std::move(r)) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
|
||||||
|
void resolve(const type_mgr& mgr) const;
|
||||||
|
void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct ast_app : public ast {
|
||||||
|
ast_ptr left;
|
||||||
|
ast_ptr right;
|
||||||
|
|
||||||
|
ast_app(ast_ptr l, ast_ptr r)
|
||||||
|
: left(std::move(l)), right(std::move(r)) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
|
||||||
|
void resolve(const type_mgr& mgr) const;
|
||||||
|
void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct ast_case : public ast {
|
||||||
|
ast_ptr of;
|
||||||
|
std::vector<branch_ptr> branches;
|
||||||
|
|
||||||
|
ast_case(ast_ptr o, std::vector<branch_ptr> b)
|
||||||
|
: of(std::move(o)), branches(std::move(b)) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
|
||||||
|
void resolve(const type_mgr& mgr) const;
|
||||||
|
void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct pattern_var : public pattern {
|
||||||
|
std::string var;
|
||||||
|
|
||||||
|
pattern_var(std::string v)
|
||||||
|
: var(std::move(v)) {}
|
||||||
|
|
||||||
|
void print(std::ostream &to) const;
|
||||||
|
void match(type_ptr t, type_mgr& mgr, type_env& env) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct pattern_constr : public pattern {
|
||||||
|
std::string constr;
|
||||||
|
std::vector<std::string> params;
|
||||||
|
|
||||||
|
pattern_constr(std::string c, std::vector<std::string> p)
|
||||||
|
: constr(std::move(c)), params(std::move(p)) {}
|
||||||
|
|
||||||
|
void print(std::ostream &to) const;
|
||||||
|
void match(type_ptr t, type_mgr&, type_env& env) const;
|
||||||
|
};
|
||||||
21
code/compiler/09/binop.cpp
Normal file
21
code/compiler/09/binop.cpp
Normal file
@@ -0,0 +1,21 @@
|
|||||||
|
#include "binop.hpp"
|
||||||
|
|
||||||
|
std::string op_name(binop op) {
|
||||||
|
switch(op) {
|
||||||
|
case PLUS: return "+";
|
||||||
|
case MINUS: return "-";
|
||||||
|
case TIMES: return "*";
|
||||||
|
case DIVIDE: return "/";
|
||||||
|
}
|
||||||
|
return "??";
|
||||||
|
}
|
||||||
|
|
||||||
|
std::string op_action(binop op) {
|
||||||
|
switch(op) {
|
||||||
|
case PLUS: return "plus";
|
||||||
|
case MINUS: return "minus";
|
||||||
|
case TIMES: return "times";
|
||||||
|
case DIVIDE: return "divide";
|
||||||
|
}
|
||||||
|
return "??";
|
||||||
|
}
|
||||||
12
code/compiler/09/binop.hpp
Normal file
12
code/compiler/09/binop.hpp
Normal file
@@ -0,0 +1,12 @@
|
|||||||
|
#pragma once
|
||||||
|
#include <string>
|
||||||
|
|
||||||
|
enum binop {
|
||||||
|
PLUS,
|
||||||
|
MINUS,
|
||||||
|
TIMES,
|
||||||
|
DIVIDE
|
||||||
|
};
|
||||||
|
|
||||||
|
std::string op_name(binop op);
|
||||||
|
std::string op_action(binop op);
|
||||||
121
code/compiler/09/definition.cpp
Normal file
121
code/compiler/09/definition.cpp
Normal file
@@ -0,0 +1,121 @@
|
|||||||
|
#include "definition.hpp"
|
||||||
|
#include "error.hpp"
|
||||||
|
#include "ast.hpp"
|
||||||
|
#include "instruction.hpp"
|
||||||
|
#include "llvm_context.hpp"
|
||||||
|
#include <llvm/IR/DerivedTypes.h>
|
||||||
|
#include <llvm/IR/Function.h>
|
||||||
|
#include <llvm/IR/Type.h>
|
||||||
|
|
||||||
|
void definition_defn::typecheck_first(type_mgr& mgr, type_env& env) {
|
||||||
|
return_type = mgr.new_type();
|
||||||
|
type_ptr full_type = return_type;
|
||||||
|
|
||||||
|
for(auto it = params.rbegin(); it != params.rend(); it++) {
|
||||||
|
type_ptr param_type = mgr.new_type();
|
||||||
|
full_type = type_ptr(new type_arr(param_type, full_type));
|
||||||
|
param_types.push_back(param_type);
|
||||||
|
}
|
||||||
|
|
||||||
|
env.bind(name, full_type);
|
||||||
|
}
|
||||||
|
|
||||||
|
void definition_defn::typecheck_second(type_mgr& mgr, const type_env& env) const {
|
||||||
|
type_env new_env = env.scope();
|
||||||
|
auto param_it = params.begin();
|
||||||
|
auto type_it = param_types.rbegin();
|
||||||
|
|
||||||
|
while(param_it != params.end() && type_it != param_types.rend()) {
|
||||||
|
new_env.bind(*param_it, *type_it);
|
||||||
|
param_it++;
|
||||||
|
type_it++;
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr body_type = body->typecheck_common(mgr, new_env);
|
||||||
|
mgr.unify(return_type, body_type);
|
||||||
|
}
|
||||||
|
|
||||||
|
void definition_defn::resolve(const type_mgr& mgr) {
|
||||||
|
type_var* var;
|
||||||
|
body->resolve_common(mgr);
|
||||||
|
|
||||||
|
return_type = mgr.resolve(return_type, var);
|
||||||
|
if(var) throw type_error("ambiguously typed program");
|
||||||
|
for(auto& param_type : param_types) {
|
||||||
|
param_type = mgr.resolve(param_type, var);
|
||||||
|
if(var) throw type_error("ambiguously typed program");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void definition_defn::compile() {
|
||||||
|
env_ptr new_env = env_ptr(new env_offset(0, nullptr));
|
||||||
|
for(auto it = params.rbegin(); it != params.rend(); it++) {
|
||||||
|
new_env = env_ptr(new env_var(*it, new_env));
|
||||||
|
}
|
||||||
|
body->compile(new_env, instructions);
|
||||||
|
instructions.push_back(instruction_ptr(new instruction_update(params.size())));
|
||||||
|
instructions.push_back(instruction_ptr(new instruction_pop(params.size())));
|
||||||
|
}
|
||||||
|
void definition_defn::gen_llvm_first(llvm_context& ctx) {
|
||||||
|
generated_function = ctx.create_custom_function(name, params.size());
|
||||||
|
}
|
||||||
|
|
||||||
|
void definition_defn::gen_llvm_second(llvm_context& ctx) {
|
||||||
|
ctx.builder.SetInsertPoint(&generated_function->getEntryBlock());
|
||||||
|
for(auto& instruction : instructions) {
|
||||||
|
instruction->gen_llvm(ctx, generated_function);
|
||||||
|
}
|
||||||
|
ctx.builder.CreateRetVoid();
|
||||||
|
}
|
||||||
|
|
||||||
|
void definition_data::typecheck_first(type_mgr& mgr, type_env& env) {
|
||||||
|
type_data* this_type = new type_data(name);
|
||||||
|
type_ptr return_type = type_ptr(this_type);
|
||||||
|
int next_tag = 0;
|
||||||
|
|
||||||
|
for(auto& constructor : constructors) {
|
||||||
|
constructor->tag = next_tag;
|
||||||
|
this_type->constructors[constructor->name] = { next_tag++ };
|
||||||
|
|
||||||
|
type_ptr full_type = return_type;
|
||||||
|
for(auto it = constructor->types.rbegin(); it != constructor->types.rend(); it++) {
|
||||||
|
type_ptr type = type_ptr(new type_base(*it));
|
||||||
|
full_type = type_ptr(new type_arr(type, full_type));
|
||||||
|
}
|
||||||
|
|
||||||
|
env.bind(constructor->name, full_type);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void definition_data::typecheck_second(type_mgr& mgr, const type_env& env) const {
|
||||||
|
// Nothing
|
||||||
|
}
|
||||||
|
|
||||||
|
void definition_data::resolve(const type_mgr& mgr) {
|
||||||
|
// Nothing
|
||||||
|
}
|
||||||
|
|
||||||
|
void definition_data::compile() {
|
||||||
|
|
||||||
|
}
|
||||||
|
|
||||||
|
void definition_data::gen_llvm_first(llvm_context& ctx) {
|
||||||
|
for(auto& constructor : constructors) {
|
||||||
|
auto new_function =
|
||||||
|
ctx.create_custom_function(constructor->name, constructor->types.size());
|
||||||
|
std::vector<instruction_ptr> instructions;
|
||||||
|
instructions.push_back(instruction_ptr(
|
||||||
|
new instruction_pack(constructor->tag, constructor->types.size())
|
||||||
|
));
|
||||||
|
instructions.push_back(instruction_ptr(new instruction_update(0)));
|
||||||
|
ctx.builder.SetInsertPoint(&new_function->getEntryBlock());
|
||||||
|
for (auto& instruction : instructions) {
|
||||||
|
instruction->gen_llvm(ctx, new_function);
|
||||||
|
}
|
||||||
|
ctx.builder.CreateRetVoid();
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void definition_data::gen_llvm_second(llvm_context& ctx) {
|
||||||
|
// Nothing
|
||||||
|
}
|
||||||
73
code/compiler/09/definition.hpp
Normal file
73
code/compiler/09/definition.hpp
Normal file
@@ -0,0 +1,73 @@
|
|||||||
|
#pragma once
|
||||||
|
#include <memory>
|
||||||
|
#include <vector>
|
||||||
|
#include "instruction.hpp"
|
||||||
|
#include "llvm_context.hpp"
|
||||||
|
#include "type_env.hpp"
|
||||||
|
|
||||||
|
struct ast;
|
||||||
|
using ast_ptr = std::unique_ptr<ast>;
|
||||||
|
|
||||||
|
struct definition {
|
||||||
|
virtual ~definition() = default;
|
||||||
|
|
||||||
|
virtual void typecheck_first(type_mgr& mgr, type_env& env) = 0;
|
||||||
|
virtual void typecheck_second(type_mgr& mgr, const type_env& env) const = 0;
|
||||||
|
virtual void resolve(const type_mgr& mgr) = 0;
|
||||||
|
virtual void compile() = 0;
|
||||||
|
virtual void gen_llvm_first(llvm_context& ctx) = 0;
|
||||||
|
virtual void gen_llvm_second(llvm_context& ctx) = 0;
|
||||||
|
};
|
||||||
|
|
||||||
|
using definition_ptr = std::unique_ptr<definition>;
|
||||||
|
|
||||||
|
struct constructor {
|
||||||
|
std::string name;
|
||||||
|
std::vector<std::string> types;
|
||||||
|
int8_t tag;
|
||||||
|
|
||||||
|
constructor(std::string n, std::vector<std::string> ts)
|
||||||
|
: name(std::move(n)), types(std::move(ts)) {}
|
||||||
|
};
|
||||||
|
|
||||||
|
using constructor_ptr = std::unique_ptr<constructor>;
|
||||||
|
|
||||||
|
struct definition_defn : public definition {
|
||||||
|
std::string name;
|
||||||
|
std::vector<std::string> params;
|
||||||
|
ast_ptr body;
|
||||||
|
|
||||||
|
type_ptr return_type;
|
||||||
|
std::vector<type_ptr> param_types;
|
||||||
|
|
||||||
|
std::vector<instruction_ptr> instructions;
|
||||||
|
|
||||||
|
llvm::Function* generated_function;
|
||||||
|
|
||||||
|
definition_defn(std::string n, std::vector<std::string> p, ast_ptr b)
|
||||||
|
: name(std::move(n)), params(std::move(p)), body(std::move(b)) {
|
||||||
|
|
||||||
|
}
|
||||||
|
|
||||||
|
void typecheck_first(type_mgr& mgr, type_env& env);
|
||||||
|
void typecheck_second(type_mgr& mgr, const type_env& env) const;
|
||||||
|
void resolve(const type_mgr& mgr);
|
||||||
|
void compile();
|
||||||
|
void gen_llvm_first(llvm_context& ctx);
|
||||||
|
void gen_llvm_second(llvm_context& ctx);
|
||||||
|
};
|
||||||
|
|
||||||
|
struct definition_data : public definition {
|
||||||
|
std::string name;
|
||||||
|
std::vector<constructor_ptr> constructors;
|
||||||
|
|
||||||
|
definition_data(std::string n, std::vector<constructor_ptr> cs)
|
||||||
|
: name(std::move(n)), constructors(std::move(cs)) {}
|
||||||
|
|
||||||
|
void typecheck_first(type_mgr& mgr, type_env& env);
|
||||||
|
void typecheck_second(type_mgr& mgr, const type_env& env) const;
|
||||||
|
void resolve(const type_mgr& mgr);
|
||||||
|
void compile();
|
||||||
|
void gen_llvm_first(llvm_context& ctx);
|
||||||
|
void gen_llvm_second(llvm_context& ctx);
|
||||||
|
};
|
||||||
23
code/compiler/09/env.cpp
Normal file
23
code/compiler/09/env.cpp
Normal file
@@ -0,0 +1,23 @@
|
|||||||
|
#include "env.hpp"
|
||||||
|
|
||||||
|
int env_var::get_offset(const std::string& name) const {
|
||||||
|
if(name == this->name) return 0;
|
||||||
|
if(parent) return parent->get_offset(name) + 1;
|
||||||
|
throw 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
bool env_var::has_variable(const std::string& name) const {
|
||||||
|
if(name == this->name) return true;
|
||||||
|
if(parent) return parent->has_variable(name);
|
||||||
|
return false;
|
||||||
|
}
|
||||||
|
|
||||||
|
int env_offset::get_offset(const std::string& name) const {
|
||||||
|
if(parent) return parent->get_offset(name) + offset;
|
||||||
|
throw 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
bool env_offset::has_variable(const std::string& name) const {
|
||||||
|
if(parent) return parent->has_variable(name);
|
||||||
|
return false;
|
||||||
|
}
|
||||||
34
code/compiler/09/env.hpp
Normal file
34
code/compiler/09/env.hpp
Normal file
@@ -0,0 +1,34 @@
|
|||||||
|
#pragma once
|
||||||
|
#include <memory>
|
||||||
|
#include <string>
|
||||||
|
|
||||||
|
struct env {
|
||||||
|
virtual ~env() = default;
|
||||||
|
|
||||||
|
virtual int get_offset(const std::string& name) const = 0;
|
||||||
|
virtual bool has_variable(const std::string& name) const = 0;
|
||||||
|
};
|
||||||
|
|
||||||
|
using env_ptr = std::shared_ptr<env>;
|
||||||
|
|
||||||
|
struct env_var : public env {
|
||||||
|
std::string name;
|
||||||
|
env_ptr parent;
|
||||||
|
|
||||||
|
env_var(std::string& n, env_ptr p)
|
||||||
|
: name(std::move(n)), parent(std::move(p)) {}
|
||||||
|
|
||||||
|
int get_offset(const std::string& name) const;
|
||||||
|
bool has_variable(const std::string& name) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct env_offset : public env {
|
||||||
|
int offset;
|
||||||
|
env_ptr parent;
|
||||||
|
|
||||||
|
env_offset(int o, env_ptr p)
|
||||||
|
: offset(o), parent(std::move(p)) {}
|
||||||
|
|
||||||
|
int get_offset(const std::string& name) const;
|
||||||
|
bool has_variable(const std::string& name) const;
|
||||||
|
};
|
||||||
5
code/compiler/09/error.cpp
Normal file
5
code/compiler/09/error.cpp
Normal file
@@ -0,0 +1,5 @@
|
|||||||
|
#include "error.hpp"
|
||||||
|
|
||||||
|
const char* type_error::what() const noexcept {
|
||||||
|
return "an error occured while checking the types of the program";
|
||||||
|
}
|
||||||
21
code/compiler/09/error.hpp
Normal file
21
code/compiler/09/error.hpp
Normal file
@@ -0,0 +1,21 @@
|
|||||||
|
#pragma once
|
||||||
|
#include <exception>
|
||||||
|
#include "type.hpp"
|
||||||
|
|
||||||
|
struct type_error : std::exception {
|
||||||
|
std::string description;
|
||||||
|
|
||||||
|
type_error(std::string d)
|
||||||
|
: description(std::move(d)) {}
|
||||||
|
|
||||||
|
const char* what() const noexcept override;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct unification_error : public type_error {
|
||||||
|
type_ptr left;
|
||||||
|
type_ptr right;
|
||||||
|
|
||||||
|
unification_error(type_ptr l, type_ptr r)
|
||||||
|
: left(std::move(l)), right(std::move(r)),
|
||||||
|
type_error("failed to unify types") {}
|
||||||
|
};
|
||||||
2
code/compiler/09/examples/bad1.txt
Normal file
2
code/compiler/09/examples/bad1.txt
Normal file
@@ -0,0 +1,2 @@
|
|||||||
|
data Bool = { True, False }
|
||||||
|
defn main = { 3 + True }
|
||||||
1
code/compiler/09/examples/bad2.txt
Normal file
1
code/compiler/09/examples/bad2.txt
Normal file
@@ -0,0 +1 @@
|
|||||||
|
defn main = { 1 2 3 4 5 }
|
||||||
8
code/compiler/09/examples/bad3.txt
Normal file
8
code/compiler/09/examples/bad3.txt
Normal file
@@ -0,0 +1,8 @@
|
|||||||
|
data List = { Nil, Cons Int List }
|
||||||
|
|
||||||
|
defn head l = {
|
||||||
|
case l of {
|
||||||
|
Nil -> { 0 }
|
||||||
|
Cons x y z -> { x }
|
||||||
|
}
|
||||||
|
}
|
||||||
31
code/compiler/09/examples/runtime1.c
Normal file
31
code/compiler/09/examples/runtime1.c
Normal file
@@ -0,0 +1,31 @@
|
|||||||
|
#include "../runtime.h"
|
||||||
|
|
||||||
|
void f_add(struct stack* s) {
|
||||||
|
struct node_num* left = (struct node_num*) eval(stack_peek(s, 0));
|
||||||
|
struct node_num* right = (struct node_num*) eval(stack_peek(s, 1));
|
||||||
|
stack_push(s, (struct node_base*) alloc_num(left->value + right->value));
|
||||||
|
}
|
||||||
|
|
||||||
|
void f_main(struct stack* s) {
|
||||||
|
// PushInt 320
|
||||||
|
stack_push(s, (struct node_base*) alloc_num(320));
|
||||||
|
|
||||||
|
// PushInt 6
|
||||||
|
stack_push(s, (struct node_base*) alloc_num(6));
|
||||||
|
|
||||||
|
// PushGlobal f_add (the function for +)
|
||||||
|
stack_push(s, (struct node_base*) alloc_global(f_add, 2));
|
||||||
|
|
||||||
|
struct node_base* left;
|
||||||
|
struct node_base* right;
|
||||||
|
|
||||||
|
// MkApp
|
||||||
|
left = stack_pop(s);
|
||||||
|
right = stack_pop(s);
|
||||||
|
stack_push(s, (struct node_base*) alloc_app(left, right));
|
||||||
|
|
||||||
|
// MkApp
|
||||||
|
left = stack_pop(s);
|
||||||
|
right = stack_pop(s);
|
||||||
|
stack_push(s, (struct node_base*) alloc_app(left, right));
|
||||||
|
}
|
||||||
3
code/compiler/09/examples/works1.txt
Normal file
3
code/compiler/09/examples/works1.txt
Normal file
@@ -0,0 +1,3 @@
|
|||||||
|
defn main = { sum 320 6 }
|
||||||
|
defn sum x y = { x + y }
|
||||||
|
|
||||||
3
code/compiler/09/examples/works2.txt
Normal file
3
code/compiler/09/examples/works2.txt
Normal file
@@ -0,0 +1,3 @@
|
|||||||
|
defn add x y = { x + y }
|
||||||
|
defn double x = { add x x }
|
||||||
|
defn main = { double 163 }
|
||||||
8
code/compiler/09/examples/works3.txt
Normal file
8
code/compiler/09/examples/works3.txt
Normal file
@@ -0,0 +1,8 @@
|
|||||||
|
data List = { Nil, Cons Int List }
|
||||||
|
defn length l = {
|
||||||
|
case l of {
|
||||||
|
Nil -> { 0 }
|
||||||
|
Cons x xs -> { 1 + length xs }
|
||||||
|
}
|
||||||
|
}
|
||||||
|
defn main = { length (Cons 1 (Cons 2 (Cons 3 Nil))) }
|
||||||
16
code/compiler/09/examples/works4.txt
Normal file
16
code/compiler/09/examples/works4.txt
Normal file
@@ -0,0 +1,16 @@
|
|||||||
|
data List = { Nil, Cons Int List }
|
||||||
|
|
||||||
|
defn add x y = { x + y }
|
||||||
|
defn mul x y = { x * y }
|
||||||
|
|
||||||
|
defn foldr f b l = {
|
||||||
|
case l of {
|
||||||
|
Nil -> { b }
|
||||||
|
Cons x xs -> { f x (foldr f b xs) }
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
defn main = {
|
||||||
|
foldr add 0 (Cons 1 (Cons 2 (Cons 3 (Cons 4 Nil)))) +
|
||||||
|
foldr mul 1 (Cons 1 (Cons 2 (Cons 3 (Cons 4 Nil))))
|
||||||
|
}
|
||||||
17
code/compiler/09/examples/works5.txt
Normal file
17
code/compiler/09/examples/works5.txt
Normal file
@@ -0,0 +1,17 @@
|
|||||||
|
data List = { Nil, Cons Int List }
|
||||||
|
|
||||||
|
defn sumZip l m = {
|
||||||
|
case l of {
|
||||||
|
Nil -> { 0 }
|
||||||
|
Cons x xs -> {
|
||||||
|
case m of {
|
||||||
|
Nil -> { 0 }
|
||||||
|
Cons y ys -> { x + y + sumZip xs ys }
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
defn ones = { Cons 1 ones }
|
||||||
|
|
||||||
|
defn main = { sumZip ones (Cons 1 (Cons 2 (Cons 3 Nil))) }
|
||||||
177
code/compiler/09/instruction.cpp
Normal file
177
code/compiler/09/instruction.cpp
Normal file
@@ -0,0 +1,177 @@
|
|||||||
|
#include "instruction.hpp"
|
||||||
|
#include "llvm_context.hpp"
|
||||||
|
#include <llvm/IR/BasicBlock.h>
|
||||||
|
#include <llvm/IR/Function.h>
|
||||||
|
|
||||||
|
using namespace llvm;
|
||||||
|
|
||||||
|
static void print_indent(int n, std::ostream& to) {
|
||||||
|
while(n--) to << " ";
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_pushint::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "PushInt(" << value << ")" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_pushint::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
ctx.create_push(f, ctx.create_num(ctx.create_i32(value)));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_pushglobal::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "PushGlobal(" << name << ")" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_pushglobal::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
auto& global_f = ctx.custom_functions.at("f_" + name);
|
||||||
|
auto arity = ctx.create_i32(global_f->arity);
|
||||||
|
ctx.create_push(f, ctx.create_global(global_f->function, arity));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_push::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "Push(" << offset << ")" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_push::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
ctx.create_push(f, ctx.create_peek(f, ctx.create_size(offset)));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_pop::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "Pop(" << count << ")" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_pop::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
ctx.create_popn(f, ctx.create_size(count));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_mkapp::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "MkApp()" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_mkapp::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
auto left = ctx.create_pop(f);
|
||||||
|
auto right = ctx.create_pop(f);
|
||||||
|
ctx.create_push(f, ctx.create_app(left, right));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_update::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "Update(" << offset << ")" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_update::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
ctx.create_update(f, ctx.create_size(offset));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_pack::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "Pack(" << tag << ", " << size << ")" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_pack::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
ctx.create_pack(f, ctx.create_size(size), ctx.create_i8(tag));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_split::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "Split()" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_split::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
ctx.create_split(f, ctx.create_size(size));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_jump::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "Jump(" << std::endl;
|
||||||
|
for(auto& instruction_set : branches) {
|
||||||
|
for(auto& instruction : instruction_set) {
|
||||||
|
instruction->print(indent + 2, to);
|
||||||
|
}
|
||||||
|
to << std::endl;
|
||||||
|
}
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << ")" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_jump::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
auto top_node = ctx.create_peek(f, ctx.create_size(0));
|
||||||
|
auto tag = ctx.unwrap_data_tag(top_node);
|
||||||
|
auto safety_block = BasicBlock::Create(ctx.ctx, "safety", f);
|
||||||
|
auto switch_op = ctx.builder.CreateSwitch(tag, safety_block, tag_mappings.size());
|
||||||
|
std::vector<BasicBlock*> blocks;
|
||||||
|
|
||||||
|
for(auto& branch : branches) {
|
||||||
|
auto branch_block = BasicBlock::Create(ctx.ctx, "branch", f);
|
||||||
|
ctx.builder.SetInsertPoint(branch_block);
|
||||||
|
for(auto& instruction : branch) {
|
||||||
|
instruction->gen_llvm(ctx, f);
|
||||||
|
}
|
||||||
|
ctx.builder.CreateBr(safety_block);
|
||||||
|
blocks.push_back(branch_block);
|
||||||
|
}
|
||||||
|
|
||||||
|
for(auto& mapping : tag_mappings) {
|
||||||
|
switch_op->addCase(ctx.create_i8(mapping.first), blocks[mapping.second]);
|
||||||
|
}
|
||||||
|
|
||||||
|
ctx.builder.SetInsertPoint(safety_block);
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_slide::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "Slide(" << offset << ")" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_slide::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
ctx.create_slide(f, ctx.create_size(offset));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_binop::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "BinOp(" << op_action(op) << ")" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_binop::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
auto left_int = ctx.unwrap_num(ctx.create_pop(f));
|
||||||
|
auto right_int = ctx.unwrap_num(ctx.create_pop(f));
|
||||||
|
llvm::Value* result;
|
||||||
|
switch(op) {
|
||||||
|
case PLUS: result = ctx.builder.CreateAdd(left_int, right_int); break;
|
||||||
|
case MINUS: result = ctx.builder.CreateSub(left_int, right_int); break;
|
||||||
|
case TIMES: result = ctx.builder.CreateMul(left_int, right_int); break;
|
||||||
|
case DIVIDE: result = ctx.builder.CreateSDiv(left_int, right_int); break;
|
||||||
|
}
|
||||||
|
ctx.create_push(f, ctx.create_num(result));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_eval::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "Eval()" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_eval::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
ctx.create_unwind(f);
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_alloc::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "Alloc(" << amount << ")" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_alloc::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
ctx.create_alloc(f, ctx.create_size(amount));
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_unwind::print(int indent, std::ostream& to) const {
|
||||||
|
print_indent(indent, to);
|
||||||
|
to << "Unwind()" << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
void instruction_unwind::gen_llvm(llvm_context& ctx, Function* f) const {
|
||||||
|
// Nothing
|
||||||
|
}
|
||||||
142
code/compiler/09/instruction.hpp
Normal file
142
code/compiler/09/instruction.hpp
Normal file
@@ -0,0 +1,142 @@
|
|||||||
|
#pragma once
|
||||||
|
#include <llvm/IR/Function.h>
|
||||||
|
#include <string>
|
||||||
|
#include <memory>
|
||||||
|
#include <vector>
|
||||||
|
#include <map>
|
||||||
|
#include <ostream>
|
||||||
|
#include "binop.hpp"
|
||||||
|
#include "llvm_context.hpp"
|
||||||
|
|
||||||
|
struct instruction {
|
||||||
|
virtual ~instruction() = default;
|
||||||
|
|
||||||
|
virtual void print(int indent, std::ostream& to) const = 0;
|
||||||
|
virtual void gen_llvm(llvm_context& ctx, llvm::Function* f) const = 0;
|
||||||
|
};
|
||||||
|
|
||||||
|
using instruction_ptr = std::unique_ptr<instruction>;
|
||||||
|
|
||||||
|
struct instruction_pushint : public instruction {
|
||||||
|
int value;
|
||||||
|
|
||||||
|
instruction_pushint(int v)
|
||||||
|
: value(v) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_pushglobal : public instruction {
|
||||||
|
std::string name;
|
||||||
|
|
||||||
|
instruction_pushglobal(std::string n)
|
||||||
|
: name(std::move(n)) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_push : public instruction {
|
||||||
|
int offset;
|
||||||
|
|
||||||
|
instruction_push(int o)
|
||||||
|
: offset(o) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_pop : public instruction {
|
||||||
|
int count;
|
||||||
|
|
||||||
|
instruction_pop(int c)
|
||||||
|
: count(c) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_mkapp : public instruction {
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_update : public instruction {
|
||||||
|
int offset;
|
||||||
|
|
||||||
|
instruction_update(int o)
|
||||||
|
: offset(o) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_pack : public instruction {
|
||||||
|
int tag;
|
||||||
|
int size;
|
||||||
|
|
||||||
|
instruction_pack(int t, int s)
|
||||||
|
: tag(t), size(s) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_split : public instruction {
|
||||||
|
int size;
|
||||||
|
|
||||||
|
instruction_split(int s)
|
||||||
|
: size(s) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_jump : public instruction {
|
||||||
|
std::vector<std::vector<instruction_ptr>> branches;
|
||||||
|
std::map<int, int> tag_mappings;
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_slide : public instruction {
|
||||||
|
int offset;
|
||||||
|
|
||||||
|
instruction_slide(int o)
|
||||||
|
: offset(o) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_binop : public instruction {
|
||||||
|
binop op;
|
||||||
|
|
||||||
|
instruction_binop(binop o)
|
||||||
|
: op(o) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_eval : public instruction {
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_alloc : public instruction {
|
||||||
|
int amount;
|
||||||
|
|
||||||
|
instruction_alloc(int a)
|
||||||
|
: amount(a) {}
|
||||||
|
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct instruction_unwind : public instruction {
|
||||||
|
void print(int indent, std::ostream& to) const;
|
||||||
|
void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
|
||||||
|
};
|
||||||
263
code/compiler/09/llvm_context.cpp
Normal file
263
code/compiler/09/llvm_context.cpp
Normal file
@@ -0,0 +1,263 @@
|
|||||||
|
#include "llvm_context.hpp"
|
||||||
|
#include <llvm/IR/DerivedTypes.h>
|
||||||
|
|
||||||
|
using namespace llvm;
|
||||||
|
|
||||||
|
void llvm_context::create_types() {
|
||||||
|
stack_type = StructType::create(ctx, "stack");
|
||||||
|
stack_ptr_type = PointerType::getUnqual(stack_type);
|
||||||
|
tag_type = IntegerType::getInt8Ty(ctx);
|
||||||
|
struct_types["node_base"] = StructType::create(ctx, "node_base");
|
||||||
|
struct_types["node_app"] = StructType::create(ctx, "node_app");
|
||||||
|
struct_types["node_num"] = StructType::create(ctx, "node_num");
|
||||||
|
struct_types["node_global"] = StructType::create(ctx, "node_global");
|
||||||
|
struct_types["node_ind"] = StructType::create(ctx, "node_ind");
|
||||||
|
struct_types["node_data"] = StructType::create(ctx, "node_data");
|
||||||
|
node_ptr_type = PointerType::getUnqual(struct_types.at("node_base"));
|
||||||
|
function_type = FunctionType::get(Type::getVoidTy(ctx), { stack_ptr_type }, false);
|
||||||
|
|
||||||
|
struct_types.at("node_base")->setBody(
|
||||||
|
IntegerType::getInt32Ty(ctx)
|
||||||
|
);
|
||||||
|
struct_types.at("node_app")->setBody(
|
||||||
|
struct_types.at("node_base"),
|
||||||
|
node_ptr_type,
|
||||||
|
node_ptr_type
|
||||||
|
);
|
||||||
|
struct_types.at("node_num")->setBody(
|
||||||
|
struct_types.at("node_base"),
|
||||||
|
IntegerType::getInt32Ty(ctx)
|
||||||
|
);
|
||||||
|
struct_types.at("node_global")->setBody(
|
||||||
|
struct_types.at("node_base"),
|
||||||
|
FunctionType::get(Type::getVoidTy(ctx), { stack_ptr_type }, false)
|
||||||
|
);
|
||||||
|
struct_types.at("node_ind")->setBody(
|
||||||
|
struct_types.at("node_base"),
|
||||||
|
node_ptr_type
|
||||||
|
);
|
||||||
|
struct_types.at("node_data")->setBody(
|
||||||
|
struct_types.at("node_base"),
|
||||||
|
IntegerType::getInt8Ty(ctx),
|
||||||
|
PointerType::getUnqual(node_ptr_type)
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
|
void llvm_context::create_functions() {
|
||||||
|
auto void_type = Type::getVoidTy(ctx);
|
||||||
|
auto sizet_type = IntegerType::get(ctx, sizeof(size_t) * 8);
|
||||||
|
functions["stack_init"] = Function::Create(
|
||||||
|
FunctionType::get(void_type, { stack_ptr_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_init",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["stack_free"] = Function::Create(
|
||||||
|
FunctionType::get(void_type, { stack_ptr_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_free",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["stack_push"] = Function::Create(
|
||||||
|
FunctionType::get(void_type, { stack_ptr_type, node_ptr_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_push",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["stack_pop"] = Function::Create(
|
||||||
|
FunctionType::get(node_ptr_type, { stack_ptr_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_pop",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["stack_peek"] = Function::Create(
|
||||||
|
FunctionType::get(node_ptr_type, { stack_ptr_type, sizet_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_peek",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["stack_popn"] = Function::Create(
|
||||||
|
FunctionType::get(void_type, { stack_ptr_type, sizet_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_popn",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["stack_slide"] = Function::Create(
|
||||||
|
FunctionType::get(void_type, { stack_ptr_type, sizet_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_slide",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["stack_update"] = Function::Create(
|
||||||
|
FunctionType::get(void_type, { stack_ptr_type, sizet_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_update",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["stack_alloc"] = Function::Create(
|
||||||
|
FunctionType::get(void_type, { stack_ptr_type, sizet_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_alloc",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["stack_pack"] = Function::Create(
|
||||||
|
FunctionType::get(void_type, { stack_ptr_type, sizet_type, tag_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_pack",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["stack_split"] = Function::Create(
|
||||||
|
FunctionType::get(node_ptr_type, { stack_ptr_type, sizet_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"stack_split",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
|
||||||
|
auto int32_type = IntegerType::getInt32Ty(ctx);
|
||||||
|
functions["alloc_app"] = Function::Create(
|
||||||
|
FunctionType::get(node_ptr_type, { node_ptr_type, node_ptr_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"alloc_app",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["alloc_num"] = Function::Create(
|
||||||
|
FunctionType::get(node_ptr_type, { int32_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"alloc_num",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["alloc_global"] = Function::Create(
|
||||||
|
FunctionType::get(node_ptr_type, { function_type, int32_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"alloc_global",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["alloc_ind"] = Function::Create(
|
||||||
|
FunctionType::get(node_ptr_type, { node_ptr_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"alloc_ind",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
|
||||||
|
functions["eval"] = Function::Create(
|
||||||
|
FunctionType::get(node_ptr_type, { node_ptr_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"eval",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
functions["unwind"] = Function::Create(
|
||||||
|
FunctionType::get(void_type, { stack_ptr_type }, false),
|
||||||
|
Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"unwind",
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
|
ConstantInt* llvm_context::create_i8(int8_t i) {
|
||||||
|
return ConstantInt::get(ctx, APInt(8, i));
|
||||||
|
}
|
||||||
|
ConstantInt* llvm_context::create_i32(int32_t i) {
|
||||||
|
return ConstantInt::get(ctx, APInt(32, i));
|
||||||
|
}
|
||||||
|
ConstantInt* llvm_context::create_size(size_t i) {
|
||||||
|
return ConstantInt::get(ctx, APInt(sizeof(size_t) * 8, i));
|
||||||
|
}
|
||||||
|
|
||||||
|
Value* llvm_context::create_pop(Function* f) {
|
||||||
|
auto pop_f = functions.at("stack_pop");
|
||||||
|
return builder.CreateCall(pop_f, { f->arg_begin() });
|
||||||
|
}
|
||||||
|
Value* llvm_context::create_peek(Function* f, Value* off) {
|
||||||
|
auto peek_f = functions.at("stack_peek");
|
||||||
|
return builder.CreateCall(peek_f, { f->arg_begin(), off });
|
||||||
|
}
|
||||||
|
void llvm_context::create_push(Function* f, Value* v) {
|
||||||
|
auto push_f = functions.at("stack_push");
|
||||||
|
builder.CreateCall(push_f, { f->arg_begin(), v });
|
||||||
|
}
|
||||||
|
void llvm_context::create_popn(Function* f, Value* off) {
|
||||||
|
auto popn_f = functions.at("stack_popn");
|
||||||
|
builder.CreateCall(popn_f, { f->arg_begin(), off });
|
||||||
|
}
|
||||||
|
void llvm_context::create_update(Function* f, Value* off) {
|
||||||
|
auto update_f = functions.at("stack_update");
|
||||||
|
builder.CreateCall(update_f, { f->arg_begin(), off });
|
||||||
|
}
|
||||||
|
void llvm_context::create_pack(Function* f, Value* c, Value* t) {
|
||||||
|
auto pack_f = functions.at("stack_pack");
|
||||||
|
builder.CreateCall(pack_f, { f->arg_begin(), c, t });
|
||||||
|
}
|
||||||
|
void llvm_context::create_split(Function* f, Value* c) {
|
||||||
|
auto split_f = functions.at("stack_split");
|
||||||
|
builder.CreateCall(split_f, { f->arg_begin(), c });
|
||||||
|
}
|
||||||
|
void llvm_context::create_slide(Function* f, Value* off) {
|
||||||
|
auto slide_f = functions.at("stack_slide");
|
||||||
|
builder.CreateCall(slide_f, { f->arg_begin(), off });
|
||||||
|
}
|
||||||
|
void llvm_context::create_alloc(Function* f, Value* n) {
|
||||||
|
auto alloc_f = functions.at("stack_alloc");
|
||||||
|
builder.CreateCall(alloc_f, { f->arg_begin(), n });
|
||||||
|
}
|
||||||
|
|
||||||
|
Value* llvm_context::create_eval(Value* e) {
|
||||||
|
auto eval_f = functions.at("eval");
|
||||||
|
return builder.CreateCall(eval_f, { e });
|
||||||
|
}
|
||||||
|
|
||||||
|
void llvm_context::create_unwind(Function* f) {
|
||||||
|
auto unwind_f = functions.at("unwind");
|
||||||
|
builder.CreateCall(unwind_f, { f->args().begin() });
|
||||||
|
}
|
||||||
|
|
||||||
|
Value* llvm_context::unwrap_num(Value* v) {
|
||||||
|
auto num_ptr_type = PointerType::getUnqual(struct_types.at("node_num"));
|
||||||
|
auto cast = builder.CreatePointerCast(v, num_ptr_type);
|
||||||
|
auto offset_0 = create_i32(0);
|
||||||
|
auto offset_1 = create_i32(1);
|
||||||
|
auto int_ptr = builder.CreateGEP(cast, { offset_0, offset_1 });
|
||||||
|
return builder.CreateLoad(int_ptr);
|
||||||
|
}
|
||||||
|
Value* llvm_context::create_num(Value* v) {
|
||||||
|
auto alloc_num_f = functions.at("alloc_num");
|
||||||
|
return builder.CreateCall(alloc_num_f, { v });
|
||||||
|
}
|
||||||
|
|
||||||
|
Value* llvm_context::unwrap_data_tag(Value* v) {
|
||||||
|
auto data_ptr_type = PointerType::getUnqual(struct_types.at("node_data"));
|
||||||
|
auto cast = builder.CreatePointerCast(v, data_ptr_type);
|
||||||
|
auto offset_0 = create_i32(0);
|
||||||
|
auto offset_1 = create_i32(1);
|
||||||
|
auto tag_ptr = builder.CreateGEP(cast, { offset_0, offset_1 });
|
||||||
|
return builder.CreateLoad(tag_ptr);
|
||||||
|
}
|
||||||
|
|
||||||
|
Value* llvm_context::create_global(Value* f, Value* a) {
|
||||||
|
auto alloc_global_f = functions.at("alloc_global");
|
||||||
|
return builder.CreateCall(alloc_global_f, { f, a });
|
||||||
|
}
|
||||||
|
|
||||||
|
Value* llvm_context::create_app(Value* l, Value* r) {
|
||||||
|
auto alloc_app_f = functions.at("alloc_app");
|
||||||
|
return builder.CreateCall(alloc_app_f, { l, r });
|
||||||
|
}
|
||||||
|
|
||||||
|
llvm::Function* llvm_context::create_custom_function(std::string name, int32_t arity) {
|
||||||
|
auto void_type = llvm::Type::getVoidTy(ctx);
|
||||||
|
auto function_type =
|
||||||
|
llvm::FunctionType::get(void_type, { stack_ptr_type }, false);
|
||||||
|
auto new_function = llvm::Function::Create(
|
||||||
|
function_type,
|
||||||
|
llvm::Function::LinkageTypes::ExternalLinkage,
|
||||||
|
"f_" + name,
|
||||||
|
&module
|
||||||
|
);
|
||||||
|
auto start_block = llvm::BasicBlock::Create(ctx, "entry", new_function);
|
||||||
|
|
||||||
|
auto new_custom_f = custom_function_ptr(new custom_function());
|
||||||
|
new_custom_f->arity = arity;
|
||||||
|
new_custom_f->function = new_function;
|
||||||
|
custom_functions["f_" + name] = std::move(new_custom_f);
|
||||||
|
|
||||||
|
return new_function;
|
||||||
|
}
|
||||||
67
code/compiler/09/llvm_context.hpp
Normal file
67
code/compiler/09/llvm_context.hpp
Normal file
@@ -0,0 +1,67 @@
|
|||||||
|
#pragma once
|
||||||
|
#include <llvm/IR/DerivedTypes.h>
|
||||||
|
#include <llvm/IR/Function.h>
|
||||||
|
#include <llvm/IR/LLVMContext.h>
|
||||||
|
#include <llvm/IR/IRBuilder.h>
|
||||||
|
#include <llvm/IR/Module.h>
|
||||||
|
#include <map>
|
||||||
|
|
||||||
|
struct llvm_context {
|
||||||
|
struct custom_function {
|
||||||
|
llvm::Function* function;
|
||||||
|
int32_t arity;
|
||||||
|
};
|
||||||
|
|
||||||
|
using custom_function_ptr = std::unique_ptr<custom_function>;
|
||||||
|
|
||||||
|
llvm::LLVMContext ctx;
|
||||||
|
llvm::IRBuilder<> builder;
|
||||||
|
llvm::Module module;
|
||||||
|
|
||||||
|
std::map<std::string, custom_function_ptr> custom_functions;
|
||||||
|
std::map<std::string, llvm::Function*> functions;
|
||||||
|
std::map<std::string, llvm::StructType*> struct_types;
|
||||||
|
|
||||||
|
llvm::StructType* stack_type;
|
||||||
|
llvm::PointerType* stack_ptr_type;
|
||||||
|
llvm::PointerType* node_ptr_type;
|
||||||
|
llvm::IntegerType* tag_type;
|
||||||
|
llvm::FunctionType* function_type;
|
||||||
|
|
||||||
|
llvm_context()
|
||||||
|
: builder(ctx), module("bloglang", ctx) {
|
||||||
|
create_types();
|
||||||
|
create_functions();
|
||||||
|
}
|
||||||
|
|
||||||
|
void create_types();
|
||||||
|
void create_functions();
|
||||||
|
|
||||||
|
llvm::ConstantInt* create_i8(int8_t);
|
||||||
|
llvm::ConstantInt* create_i32(int32_t);
|
||||||
|
llvm::ConstantInt* create_size(size_t);
|
||||||
|
|
||||||
|
llvm::Value* create_pop(llvm::Function*);
|
||||||
|
llvm::Value* create_peek(llvm::Function*, llvm::Value*);
|
||||||
|
void create_push(llvm::Function*, llvm::Value*);
|
||||||
|
void create_popn(llvm::Function*, llvm::Value*);
|
||||||
|
void create_update(llvm::Function*, llvm::Value*);
|
||||||
|
void create_pack(llvm::Function*, llvm::Value*, llvm::Value*);
|
||||||
|
void create_split(llvm::Function*, llvm::Value*);
|
||||||
|
void create_slide(llvm::Function*, llvm::Value*);
|
||||||
|
void create_alloc(llvm::Function*, llvm::Value*);
|
||||||
|
|
||||||
|
llvm::Value* create_eval(llvm::Value*);
|
||||||
|
void create_unwind(llvm::Function*);
|
||||||
|
|
||||||
|
llvm::Value* unwrap_num(llvm::Value*);
|
||||||
|
llvm::Value* create_num(llvm::Value*);
|
||||||
|
|
||||||
|
llvm::Value* unwrap_data_tag(llvm::Value*);
|
||||||
|
|
||||||
|
llvm::Value* create_global(llvm::Value*, llvm::Value*);
|
||||||
|
|
||||||
|
llvm::Value* create_app(llvm::Value*, llvm::Value*);
|
||||||
|
|
||||||
|
llvm::Function* create_custom_function(std::string name, int32_t arity);
|
||||||
|
};
|
||||||
176
code/compiler/09/main.cpp
Normal file
176
code/compiler/09/main.cpp
Normal file
@@ -0,0 +1,176 @@
|
|||||||
|
#include "ast.hpp"
|
||||||
|
#include <iostream>
|
||||||
|
#include "binop.hpp"
|
||||||
|
#include "definition.hpp"
|
||||||
|
#include "instruction.hpp"
|
||||||
|
#include "llvm_context.hpp"
|
||||||
|
#include "parser.hpp"
|
||||||
|
#include "error.hpp"
|
||||||
|
#include "type.hpp"
|
||||||
|
#include "llvm/IR/LegacyPassManager.h"
|
||||||
|
#include "llvm/IR/Verifier.h"
|
||||||
|
#include "llvm/Support/TargetSelect.h"
|
||||||
|
#include "llvm/Support/TargetRegistry.h"
|
||||||
|
#include "llvm/Support/raw_ostream.h"
|
||||||
|
#include "llvm/Support/FileSystem.h"
|
||||||
|
#include "llvm/Target/TargetOptions.h"
|
||||||
|
#include "llvm/Target/TargetMachine.h"
|
||||||
|
|
||||||
|
void yy::parser::error(const std::string& msg) {
|
||||||
|
std::cout << "An error occured: " << msg << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
extern std::vector<definition_ptr> program;
|
||||||
|
|
||||||
|
void typecheck_program(
|
||||||
|
const std::vector<definition_ptr>& prog,
|
||||||
|
type_mgr& mgr, type_env& env) {
|
||||||
|
type_ptr int_type = type_ptr(new type_base("Int"));
|
||||||
|
type_ptr binop_type = type_ptr(new type_arr(
|
||||||
|
int_type,
|
||||||
|
type_ptr(new type_arr(int_type, int_type))));
|
||||||
|
|
||||||
|
env.bind("+", binop_type);
|
||||||
|
env.bind("-", binop_type);
|
||||||
|
env.bind("*", binop_type);
|
||||||
|
env.bind("/", binop_type);
|
||||||
|
|
||||||
|
for(auto& def : prog) {
|
||||||
|
def->typecheck_first(mgr, env);
|
||||||
|
}
|
||||||
|
|
||||||
|
for(auto& def : prog) {
|
||||||
|
def->typecheck_second(mgr, env);
|
||||||
|
}
|
||||||
|
|
||||||
|
for(auto& pair : env.names) {
|
||||||
|
std::cout << pair.first << ": ";
|
||||||
|
pair.second->print(mgr, std::cout);
|
||||||
|
std::cout << std::endl;
|
||||||
|
}
|
||||||
|
|
||||||
|
for(auto& def : prog) {
|
||||||
|
def->resolve(mgr);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void compile_program(const std::vector<definition_ptr>& prog) {
|
||||||
|
for(auto& def : prog) {
|
||||||
|
def->compile();
|
||||||
|
|
||||||
|
definition_defn* defn = dynamic_cast<definition_defn*>(def.get());
|
||||||
|
if(!defn) continue;
|
||||||
|
for(auto& instruction : defn->instructions) {
|
||||||
|
instruction->print(0, std::cout);
|
||||||
|
}
|
||||||
|
std::cout << std::endl;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void gen_llvm_internal_op(llvm_context& ctx, binop op) {
|
||||||
|
auto new_function = ctx.create_custom_function(op_action(op), 2);
|
||||||
|
std::vector<instruction_ptr> instructions;
|
||||||
|
instructions.push_back(instruction_ptr(new instruction_push(1)));
|
||||||
|
instructions.push_back(instruction_ptr(new instruction_eval()));
|
||||||
|
instructions.push_back(instruction_ptr(new instruction_push(1)));
|
||||||
|
instructions.push_back(instruction_ptr(new instruction_eval()));
|
||||||
|
instructions.push_back(instruction_ptr(new instruction_binop(op)));
|
||||||
|
instructions.push_back(instruction_ptr(new instruction_update(2)));
|
||||||
|
instructions.push_back(instruction_ptr(new instruction_pop(2)));
|
||||||
|
ctx.builder.SetInsertPoint(&new_function->getEntryBlock());
|
||||||
|
for(auto& instruction : instructions) {
|
||||||
|
instruction->gen_llvm(ctx, new_function);
|
||||||
|
}
|
||||||
|
ctx.builder.CreateRetVoid();
|
||||||
|
}
|
||||||
|
|
||||||
|
void output_llvm(llvm_context& ctx, const std::string& filename) {
|
||||||
|
std::string targetTriple = llvm::sys::getDefaultTargetTriple();
|
||||||
|
|
||||||
|
llvm::InitializeNativeTarget();
|
||||||
|
llvm::InitializeNativeTargetAsmParser();
|
||||||
|
llvm::InitializeNativeTargetAsmPrinter();
|
||||||
|
|
||||||
|
std::string error;
|
||||||
|
const llvm::Target* target =
|
||||||
|
llvm::TargetRegistry::lookupTarget(targetTriple, error);
|
||||||
|
if (!target) {
|
||||||
|
std::cerr << error << std::endl;
|
||||||
|
} else {
|
||||||
|
std::string cpu = "generic";
|
||||||
|
std::string features = "";
|
||||||
|
llvm::TargetOptions options;
|
||||||
|
llvm::TargetMachine* targetMachine =
|
||||||
|
target->createTargetMachine(targetTriple, cpu, features,
|
||||||
|
options, llvm::Optional<llvm::Reloc::Model>());
|
||||||
|
|
||||||
|
ctx.module.setDataLayout(targetMachine->createDataLayout());
|
||||||
|
ctx.module.setTargetTriple(targetTriple);
|
||||||
|
|
||||||
|
std::error_code ec;
|
||||||
|
llvm::raw_fd_ostream file(filename, ec, llvm::sys::fs::F_None);
|
||||||
|
if (ec) {
|
||||||
|
throw 0;
|
||||||
|
} else {
|
||||||
|
llvm::TargetMachine::CodeGenFileType type = llvm::TargetMachine::CGFT_ObjectFile;
|
||||||
|
llvm::legacy::PassManager pm;
|
||||||
|
if (targetMachine->addPassesToEmitFile(pm, file, NULL, type)) {
|
||||||
|
throw 0;
|
||||||
|
} else {
|
||||||
|
pm.run(ctx.module);
|
||||||
|
file.close();
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void gen_llvm(const std::vector<definition_ptr>& prog) {
|
||||||
|
llvm_context ctx;
|
||||||
|
gen_llvm_internal_op(ctx, PLUS);
|
||||||
|
gen_llvm_internal_op(ctx, MINUS);
|
||||||
|
gen_llvm_internal_op(ctx, TIMES);
|
||||||
|
gen_llvm_internal_op(ctx, DIVIDE);
|
||||||
|
|
||||||
|
for(auto& definition : prog) {
|
||||||
|
definition->gen_llvm_first(ctx);
|
||||||
|
}
|
||||||
|
|
||||||
|
for(auto& definition : prog) {
|
||||||
|
definition->gen_llvm_second(ctx);
|
||||||
|
}
|
||||||
|
ctx.module.print(llvm::outs(), nullptr);
|
||||||
|
output_llvm(ctx, "program.o");
|
||||||
|
}
|
||||||
|
|
||||||
|
int main() {
|
||||||
|
yy::parser parser;
|
||||||
|
type_mgr mgr;
|
||||||
|
type_env env;
|
||||||
|
|
||||||
|
parser.parse();
|
||||||
|
for(auto& definition : program) {
|
||||||
|
definition_defn* def = dynamic_cast<definition_defn*>(definition.get());
|
||||||
|
if(!def) continue;
|
||||||
|
|
||||||
|
std::cout << def->name;
|
||||||
|
for(auto& param : def->params) std::cout << " " << param;
|
||||||
|
std::cout << ":" << std::endl;
|
||||||
|
|
||||||
|
def->body->print(1, std::cout);
|
||||||
|
}
|
||||||
|
try {
|
||||||
|
typecheck_program(program, mgr, env);
|
||||||
|
compile_program(program);
|
||||||
|
gen_llvm(program);
|
||||||
|
} catch(unification_error& err) {
|
||||||
|
std::cout << "failed to unify types: " << std::endl;
|
||||||
|
std::cout << " (1) \033[34m";
|
||||||
|
err.left->print(mgr, std::cout);
|
||||||
|
std::cout << "\033[0m" << std::endl;
|
||||||
|
std::cout << " (2) \033[32m";
|
||||||
|
err.right->print(mgr, std::cout);
|
||||||
|
std::cout << "\033[0m" << std::endl;
|
||||||
|
} catch(type_error& err) {
|
||||||
|
std::cout << "failed to type check program: " << err.description << std::endl;
|
||||||
|
}
|
||||||
|
}
|
||||||
141
code/compiler/09/parser.y
Normal file
141
code/compiler/09/parser.y
Normal file
@@ -0,0 +1,141 @@
|
|||||||
|
%{
|
||||||
|
#include <string>
|
||||||
|
#include <iostream>
|
||||||
|
#include "ast.hpp"
|
||||||
|
#include "definition.hpp"
|
||||||
|
#include "parser.hpp"
|
||||||
|
|
||||||
|
std::vector<definition_ptr> program;
|
||||||
|
extern yy::parser::symbol_type yylex();
|
||||||
|
|
||||||
|
%}
|
||||||
|
|
||||||
|
%token PLUS
|
||||||
|
%token TIMES
|
||||||
|
%token MINUS
|
||||||
|
%token DIVIDE
|
||||||
|
%token <int> INT
|
||||||
|
%token DEFN
|
||||||
|
%token DATA
|
||||||
|
%token CASE
|
||||||
|
%token OF
|
||||||
|
%token OCURLY
|
||||||
|
%token CCURLY
|
||||||
|
%token OPAREN
|
||||||
|
%token CPAREN
|
||||||
|
%token COMMA
|
||||||
|
%token ARROW
|
||||||
|
%token EQUAL
|
||||||
|
%token <std::string> LID
|
||||||
|
%token <std::string> UID
|
||||||
|
|
||||||
|
%language "c++"
|
||||||
|
%define api.value.type variant
|
||||||
|
%define api.token.constructor
|
||||||
|
|
||||||
|
%type <std::vector<std::string>> lowercaseParams uppercaseParams
|
||||||
|
%type <std::vector<definition_ptr>> program definitions
|
||||||
|
%type <std::vector<branch_ptr>> branches
|
||||||
|
%type <std::vector<constructor_ptr>> constructors
|
||||||
|
%type <ast_ptr> aAdd aMul case app appBase
|
||||||
|
%type <definition_ptr> definition defn data
|
||||||
|
%type <branch_ptr> branch
|
||||||
|
%type <pattern_ptr> pattern
|
||||||
|
%type <constructor_ptr> constructor
|
||||||
|
|
||||||
|
%start program
|
||||||
|
|
||||||
|
%%
|
||||||
|
|
||||||
|
program
|
||||||
|
: definitions { program = std::move($1); }
|
||||||
|
;
|
||||||
|
|
||||||
|
definitions
|
||||||
|
: definitions definition { $$ = std::move($1); $$.push_back(std::move($2)); }
|
||||||
|
| definition { $$ = std::vector<definition_ptr>(); $$.push_back(std::move($1)); }
|
||||||
|
;
|
||||||
|
|
||||||
|
definition
|
||||||
|
: defn { $$ = std::move($1); }
|
||||||
|
| data { $$ = std::move($1); }
|
||||||
|
;
|
||||||
|
|
||||||
|
defn
|
||||||
|
: DEFN LID lowercaseParams EQUAL OCURLY aAdd CCURLY
|
||||||
|
{ $$ = definition_ptr(
|
||||||
|
new definition_defn(std::move($2), std::move($3), std::move($6))); }
|
||||||
|
;
|
||||||
|
|
||||||
|
lowercaseParams
|
||||||
|
: %empty { $$ = std::vector<std::string>(); }
|
||||||
|
| lowercaseParams LID { $$ = std::move($1); $$.push_back(std::move($2)); }
|
||||||
|
;
|
||||||
|
|
||||||
|
uppercaseParams
|
||||||
|
: %empty { $$ = std::vector<std::string>(); }
|
||||||
|
| uppercaseParams UID { $$ = std::move($1); $$.push_back(std::move($2)); }
|
||||||
|
;
|
||||||
|
|
||||||
|
aAdd
|
||||||
|
: aAdd PLUS aMul { $$ = ast_ptr(new ast_binop(PLUS, std::move($1), std::move($3))); }
|
||||||
|
| aAdd MINUS aMul { $$ = ast_ptr(new ast_binop(MINUS, std::move($1), std::move($3))); }
|
||||||
|
| aMul { $$ = std::move($1); }
|
||||||
|
;
|
||||||
|
|
||||||
|
aMul
|
||||||
|
: aMul TIMES app { $$ = ast_ptr(new ast_binop(TIMES, std::move($1), std::move($3))); }
|
||||||
|
| aMul DIVIDE app { $$ = ast_ptr(new ast_binop(DIVIDE, std::move($1), std::move($3))); }
|
||||||
|
| app { $$ = std::move($1); }
|
||||||
|
;
|
||||||
|
|
||||||
|
app
|
||||||
|
: app appBase { $$ = ast_ptr(new ast_app(std::move($1), std::move($2))); }
|
||||||
|
| appBase { $$ = std::move($1); }
|
||||||
|
;
|
||||||
|
|
||||||
|
appBase
|
||||||
|
: INT { $$ = ast_ptr(new ast_int($1)); }
|
||||||
|
| LID { $$ = ast_ptr(new ast_lid(std::move($1))); }
|
||||||
|
| UID { $$ = ast_ptr(new ast_uid(std::move($1))); }
|
||||||
|
| OPAREN aAdd CPAREN { $$ = std::move($2); }
|
||||||
|
| case { $$ = std::move($1); }
|
||||||
|
;
|
||||||
|
|
||||||
|
case
|
||||||
|
: CASE aAdd OF OCURLY branches CCURLY
|
||||||
|
{ $$ = ast_ptr(new ast_case(std::move($2), std::move($5))); }
|
||||||
|
;
|
||||||
|
|
||||||
|
branches
|
||||||
|
: branches branch { $$ = std::move($1); $$.push_back(std::move($2)); }
|
||||||
|
| branch { $$ = std::vector<branch_ptr>(); $$.push_back(std::move($1));}
|
||||||
|
;
|
||||||
|
|
||||||
|
branch
|
||||||
|
: pattern ARROW OCURLY aAdd CCURLY
|
||||||
|
{ $$ = branch_ptr(new branch(std::move($1), std::move($4))); }
|
||||||
|
;
|
||||||
|
|
||||||
|
pattern
|
||||||
|
: LID { $$ = pattern_ptr(new pattern_var(std::move($1))); }
|
||||||
|
| UID lowercaseParams
|
||||||
|
{ $$ = pattern_ptr(new pattern_constr(std::move($1), std::move($2))); }
|
||||||
|
;
|
||||||
|
|
||||||
|
data
|
||||||
|
: DATA UID EQUAL OCURLY constructors CCURLY
|
||||||
|
{ $$ = definition_ptr(new definition_data(std::move($2), std::move($5))); }
|
||||||
|
;
|
||||||
|
|
||||||
|
constructors
|
||||||
|
: constructors COMMA constructor { $$ = std::move($1); $$.push_back(std::move($3)); }
|
||||||
|
| constructor
|
||||||
|
{ $$ = std::vector<constructor_ptr>(); $$.push_back(std::move($1)); }
|
||||||
|
;
|
||||||
|
|
||||||
|
constructor
|
||||||
|
: UID uppercaseParams
|
||||||
|
{ $$ = constructor_ptr(new constructor(std::move($1), std::move($2))); }
|
||||||
|
;
|
||||||
|
|
||||||
183
code/compiler/09/runtime.c
Normal file
183
code/compiler/09/runtime.c
Normal file
@@ -0,0 +1,183 @@
|
|||||||
|
#include <stdint.h>
|
||||||
|
#include <assert.h>
|
||||||
|
#include <memory.h>
|
||||||
|
#include <stdio.h>
|
||||||
|
#include "runtime.h"
|
||||||
|
|
||||||
|
struct node_base* alloc_node() {
|
||||||
|
struct node_base* new_node = malloc(sizeof(struct node_app));
|
||||||
|
assert(new_node != NULL);
|
||||||
|
return new_node;
|
||||||
|
}
|
||||||
|
|
||||||
|
struct node_app* alloc_app(struct node_base* l, struct node_base* r) {
|
||||||
|
struct node_app* node = (struct node_app*) alloc_node();
|
||||||
|
node->base.tag = NODE_APP;
|
||||||
|
node->left = l;
|
||||||
|
node->right = r;
|
||||||
|
return node;
|
||||||
|
}
|
||||||
|
|
||||||
|
struct node_num* alloc_num(int32_t n) {
|
||||||
|
struct node_num* node = (struct node_num*) alloc_node();
|
||||||
|
node->base.tag = NODE_NUM;
|
||||||
|
node->value = n;
|
||||||
|
return node;
|
||||||
|
}
|
||||||
|
|
||||||
|
struct node_global* alloc_global(void (*f)(struct stack*), int32_t a) {
|
||||||
|
struct node_global* node = (struct node_global*) alloc_node();
|
||||||
|
node->base.tag = NODE_GLOBAL;
|
||||||
|
node->arity = a;
|
||||||
|
node->function = f;
|
||||||
|
return node;
|
||||||
|
}
|
||||||
|
|
||||||
|
struct node_ind* alloc_ind(struct node_base* n) {
|
||||||
|
struct node_ind* node = (struct node_ind*) alloc_node();
|
||||||
|
node->base.tag = NODE_IND;
|
||||||
|
node->next = n;
|
||||||
|
return node;
|
||||||
|
}
|
||||||
|
|
||||||
|
void stack_init(struct stack* s) {
|
||||||
|
s->size = 4;
|
||||||
|
s->count = 0;
|
||||||
|
s->data = malloc(sizeof(*s->data) * s->size);
|
||||||
|
assert(s->data != NULL);
|
||||||
|
}
|
||||||
|
|
||||||
|
void stack_free(struct stack* s) {
|
||||||
|
free(s->data);
|
||||||
|
}
|
||||||
|
|
||||||
|
void stack_push(struct stack* s, struct node_base* n) {
|
||||||
|
while(s->count >= s->size) {
|
||||||
|
s->data = realloc(s->data, sizeof(*s->data) * (s->size *= 2));
|
||||||
|
assert(s->data != NULL);
|
||||||
|
}
|
||||||
|
s->data[s->count++] = n;
|
||||||
|
}
|
||||||
|
|
||||||
|
struct node_base* stack_pop(struct stack* s) {
|
||||||
|
assert(s->count > 0);
|
||||||
|
return s->data[--s->count];
|
||||||
|
}
|
||||||
|
|
||||||
|
struct node_base* stack_peek(struct stack* s, size_t o) {
|
||||||
|
assert(s->count > o);
|
||||||
|
return s->data[s->count - o - 1];
|
||||||
|
}
|
||||||
|
|
||||||
|
void stack_popn(struct stack* s, size_t n) {
|
||||||
|
assert(s->count >= n);
|
||||||
|
s->count -= n;
|
||||||
|
}
|
||||||
|
|
||||||
|
void stack_slide(struct stack* s, size_t n) {
|
||||||
|
assert(s->count > n);
|
||||||
|
s->data[s->count - n - 1] = s->data[s->count - 1];
|
||||||
|
s->count -= n;
|
||||||
|
}
|
||||||
|
|
||||||
|
void stack_update(struct stack* s, size_t o) {
|
||||||
|
assert(s->count > o + 1);
|
||||||
|
struct node_ind* ind = (struct node_ind*) s->data[s->count - o - 2];
|
||||||
|
ind->base.tag = NODE_IND;
|
||||||
|
ind->next = s->data[s->count -= 1];
|
||||||
|
}
|
||||||
|
|
||||||
|
void stack_alloc(struct stack* s, size_t o) {
|
||||||
|
while(o--) {
|
||||||
|
stack_push(s, (struct node_base*) alloc_ind(NULL));
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void stack_pack(struct stack* s, size_t n, int8_t t) {
|
||||||
|
assert(s->count >= n);
|
||||||
|
|
||||||
|
struct node_base** data = malloc(sizeof(*data) * n);
|
||||||
|
assert(data != NULL);
|
||||||
|
memcpy(data, &s->data[s->count - n], n * sizeof(*data));
|
||||||
|
|
||||||
|
struct node_data* new_node = (struct node_data*) alloc_node();
|
||||||
|
new_node->array = data;
|
||||||
|
new_node->base.tag = NODE_DATA;
|
||||||
|
new_node->tag = t;
|
||||||
|
|
||||||
|
stack_popn(s, n);
|
||||||
|
stack_push(s, (struct node_base*) new_node);
|
||||||
|
}
|
||||||
|
|
||||||
|
void stack_split(struct stack* s, size_t n) {
|
||||||
|
struct node_data* node = (struct node_data*) stack_pop(s);
|
||||||
|
for(size_t i = 0; i < n; i++) {
|
||||||
|
stack_push(s, node->array[i]);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void unwind(struct stack* s) {
|
||||||
|
while(1) {
|
||||||
|
struct node_base* peek = stack_peek(s, 0);
|
||||||
|
if(peek->tag == NODE_APP) {
|
||||||
|
struct node_app* n = (struct node_app*) peek;
|
||||||
|
stack_push(s, n->left);
|
||||||
|
} else if(peek->tag == NODE_GLOBAL) {
|
||||||
|
struct node_global* n = (struct node_global*) peek;
|
||||||
|
assert(s->count > n->arity);
|
||||||
|
|
||||||
|
for(size_t i = 1; i <= n->arity; i++) {
|
||||||
|
s->data[s->count - i]
|
||||||
|
= ((struct node_app*) s->data[s->count - i - 1])->right;
|
||||||
|
}
|
||||||
|
|
||||||
|
n->function(s);
|
||||||
|
} else if(peek->tag == NODE_IND) {
|
||||||
|
struct node_ind* n = (struct node_ind*) peek;
|
||||||
|
stack_pop(s);
|
||||||
|
stack_push(s, n->next);
|
||||||
|
} else {
|
||||||
|
break;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
struct node_base* eval(struct node_base* n) {
|
||||||
|
struct stack program_stack;
|
||||||
|
stack_init(&program_stack);
|
||||||
|
stack_push(&program_stack, n);
|
||||||
|
unwind(&program_stack);
|
||||||
|
struct node_base* result = stack_pop(&program_stack);
|
||||||
|
stack_free(&program_stack);
|
||||||
|
return result;
|
||||||
|
}
|
||||||
|
|
||||||
|
extern void f_main(struct stack* s);
|
||||||
|
|
||||||
|
void print_node(struct node_base* n) {
|
||||||
|
if(n->tag == NODE_APP) {
|
||||||
|
struct node_app* app = (struct node_app*) n;
|
||||||
|
print_node(app->left);
|
||||||
|
putchar(' ');
|
||||||
|
print_node(app->right);
|
||||||
|
} else if(n->tag == NODE_DATA) {
|
||||||
|
printf("(Packed)");
|
||||||
|
} else if(n->tag == NODE_GLOBAL) {
|
||||||
|
struct node_global* global = (struct node_global*) n;
|
||||||
|
printf("(Global: %p)", global->function);
|
||||||
|
} else if(n->tag == NODE_IND) {
|
||||||
|
print_node(((struct node_ind*) n)->next);
|
||||||
|
} else if(n->tag == NODE_NUM) {
|
||||||
|
struct node_num* num = (struct node_num*) n;
|
||||||
|
printf("%d", num->value);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
int main(int argc, char** argv) {
|
||||||
|
struct node_global* first_node = alloc_global(f_main, 0);
|
||||||
|
struct node_base* result = eval((struct node_base*) first_node);
|
||||||
|
|
||||||
|
printf("Result: ");
|
||||||
|
print_node(result);
|
||||||
|
putchar('\n');
|
||||||
|
}
|
||||||
70
code/compiler/09/runtime.h
Normal file
70
code/compiler/09/runtime.h
Normal file
@@ -0,0 +1,70 @@
|
|||||||
|
#pragma once
|
||||||
|
#include <stdlib.h>
|
||||||
|
|
||||||
|
struct stack;
|
||||||
|
|
||||||
|
enum node_tag {
|
||||||
|
NODE_APP,
|
||||||
|
NODE_NUM,
|
||||||
|
NODE_GLOBAL,
|
||||||
|
NODE_IND,
|
||||||
|
NODE_DATA
|
||||||
|
};
|
||||||
|
|
||||||
|
struct node_base {
|
||||||
|
enum node_tag tag;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct node_app {
|
||||||
|
struct node_base base;
|
||||||
|
struct node_base* left;
|
||||||
|
struct node_base* right;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct node_num {
|
||||||
|
struct node_base base;
|
||||||
|
int32_t value;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct node_global {
|
||||||
|
struct node_base base;
|
||||||
|
int32_t arity;
|
||||||
|
void (*function)(struct stack*);
|
||||||
|
};
|
||||||
|
|
||||||
|
struct node_ind {
|
||||||
|
struct node_base base;
|
||||||
|
struct node_base* next;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct node_data {
|
||||||
|
struct node_base base;
|
||||||
|
int8_t tag;
|
||||||
|
struct node_base** array;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct node_base* alloc_node();
|
||||||
|
struct node_app* alloc_app(struct node_base* l, struct node_base* r);
|
||||||
|
struct node_num* alloc_num(int32_t n);
|
||||||
|
struct node_global* alloc_global(void (*f)(struct stack*), int32_t a);
|
||||||
|
struct node_ind* alloc_ind(struct node_base* n);
|
||||||
|
|
||||||
|
struct stack {
|
||||||
|
size_t size;
|
||||||
|
size_t count;
|
||||||
|
struct node_base** data;
|
||||||
|
};
|
||||||
|
|
||||||
|
void stack_init(struct stack* s);
|
||||||
|
void stack_free(struct stack* s);
|
||||||
|
void stack_push(struct stack* s, struct node_base* n);
|
||||||
|
struct node_base* stack_pop(struct stack* s);
|
||||||
|
struct node_base* stack_peek(struct stack* s, size_t o);
|
||||||
|
void stack_popn(struct stack* s, size_t n);
|
||||||
|
void stack_slide(struct stack* s, size_t n);
|
||||||
|
void stack_update(struct stack* s, size_t o);
|
||||||
|
void stack_alloc(struct stack* s, size_t o);
|
||||||
|
void stack_pack(struct stack* s, size_t n, int8_t t);
|
||||||
|
void stack_split(struct stack* s, size_t n);
|
||||||
|
|
||||||
|
struct node_base* eval(struct node_base* n);
|
||||||
35
code/compiler/09/scanner.l
Normal file
35
code/compiler/09/scanner.l
Normal file
@@ -0,0 +1,35 @@
|
|||||||
|
%option noyywrap
|
||||||
|
|
||||||
|
%{
|
||||||
|
#include <iostream>
|
||||||
|
#include "ast.hpp"
|
||||||
|
#include "definition.hpp"
|
||||||
|
#include "parser.hpp"
|
||||||
|
|
||||||
|
#define YY_DECL yy::parser::symbol_type yylex()
|
||||||
|
|
||||||
|
%}
|
||||||
|
|
||||||
|
%%
|
||||||
|
|
||||||
|
[ \n]+ {}
|
||||||
|
\+ { return yy::parser::make_PLUS(); }
|
||||||
|
\* { return yy::parser::make_TIMES(); }
|
||||||
|
- { return yy::parser::make_MINUS(); }
|
||||||
|
\/ { return yy::parser::make_DIVIDE(); }
|
||||||
|
[0-9]+ { return yy::parser::make_INT(atoi(yytext)); }
|
||||||
|
defn { return yy::parser::make_DEFN(); }
|
||||||
|
data { return yy::parser::make_DATA(); }
|
||||||
|
case { return yy::parser::make_CASE(); }
|
||||||
|
of { return yy::parser::make_OF(); }
|
||||||
|
\{ { return yy::parser::make_OCURLY(); }
|
||||||
|
\} { return yy::parser::make_CCURLY(); }
|
||||||
|
\( { return yy::parser::make_OPAREN(); }
|
||||||
|
\) { return yy::parser::make_CPAREN(); }
|
||||||
|
, { return yy::parser::make_COMMA(); }
|
||||||
|
-> { return yy::parser::make_ARROW(); }
|
||||||
|
= { return yy::parser::make_EQUAL(); }
|
||||||
|
[a-z][a-zA-Z]* { return yy::parser::make_LID(std::string(yytext)); }
|
||||||
|
[A-Z][a-zA-Z]* { return yy::parser::make_UID(std::string(yytext)); }
|
||||||
|
|
||||||
|
%%
|
||||||
99
code/compiler/09/type.cpp
Normal file
99
code/compiler/09/type.cpp
Normal file
@@ -0,0 +1,99 @@
|
|||||||
|
#include "type.hpp"
|
||||||
|
#include <sstream>
|
||||||
|
#include <algorithm>
|
||||||
|
#include "error.hpp"
|
||||||
|
|
||||||
|
void type_var::print(const type_mgr& mgr, std::ostream& to) const {
|
||||||
|
auto it = mgr.types.find(name);
|
||||||
|
if(it != mgr.types.end()) {
|
||||||
|
it->second->print(mgr, to);
|
||||||
|
} else {
|
||||||
|
to << name;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void type_base::print(const type_mgr& mgr, std::ostream& to) const {
|
||||||
|
to << name;
|
||||||
|
}
|
||||||
|
|
||||||
|
void type_arr::print(const type_mgr& mgr, std::ostream& to) const {
|
||||||
|
left->print(mgr, to);
|
||||||
|
to << " -> (";
|
||||||
|
right->print(mgr, to);
|
||||||
|
to << ")";
|
||||||
|
}
|
||||||
|
|
||||||
|
std::string type_mgr::new_type_name() {
|
||||||
|
int temp = last_id++;
|
||||||
|
std::string str = "";
|
||||||
|
|
||||||
|
while(temp != -1) {
|
||||||
|
str += (char) ('a' + (temp % 26));
|
||||||
|
temp = temp / 26 - 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
std::reverse(str.begin(), str.end());
|
||||||
|
return str;
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr type_mgr::new_type() {
|
||||||
|
return type_ptr(new type_var(new_type_name()));
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr type_mgr::new_arrow_type() {
|
||||||
|
return type_ptr(new type_arr(new_type(), new_type()));
|
||||||
|
}
|
||||||
|
|
||||||
|
type_ptr type_mgr::resolve(type_ptr t, type_var*& var) const {
|
||||||
|
type_var* cast;
|
||||||
|
|
||||||
|
var = nullptr;
|
||||||
|
while((cast = dynamic_cast<type_var*>(t.get()))) {
|
||||||
|
auto it = types.find(cast->name);
|
||||||
|
|
||||||
|
if(it == types.end()) {
|
||||||
|
var = cast;
|
||||||
|
break;
|
||||||
|
}
|
||||||
|
t = it->second;
|
||||||
|
}
|
||||||
|
|
||||||
|
return t;
|
||||||
|
}
|
||||||
|
|
||||||
|
void type_mgr::unify(type_ptr l, type_ptr r) {
|
||||||
|
type_var* lvar;
|
||||||
|
type_var* rvar;
|
||||||
|
type_arr* larr;
|
||||||
|
type_arr* rarr;
|
||||||
|
type_base* lid;
|
||||||
|
type_base* rid;
|
||||||
|
|
||||||
|
l = resolve(l, lvar);
|
||||||
|
r = resolve(r, rvar);
|
||||||
|
|
||||||
|
if(lvar) {
|
||||||
|
bind(lvar->name, r);
|
||||||
|
return;
|
||||||
|
} else if(rvar) {
|
||||||
|
bind(rvar->name, l);
|
||||||
|
return;
|
||||||
|
} else if((larr = dynamic_cast<type_arr*>(l.get())) &&
|
||||||
|
(rarr = dynamic_cast<type_arr*>(r.get()))) {
|
||||||
|
unify(larr->left, rarr->left);
|
||||||
|
unify(larr->right, rarr->right);
|
||||||
|
return;
|
||||||
|
} else if((lid = dynamic_cast<type_base*>(l.get())) &&
|
||||||
|
(rid = dynamic_cast<type_base*>(r.get()))) {
|
||||||
|
if(lid->name == rid->name) return;
|
||||||
|
}
|
||||||
|
|
||||||
|
throw unification_error(l, r);
|
||||||
|
}
|
||||||
|
|
||||||
|
void type_mgr::bind(const std::string& s, type_ptr t) {
|
||||||
|
type_var* other = dynamic_cast<type_var*>(t.get());
|
||||||
|
|
||||||
|
if(other && other->name == s) return;
|
||||||
|
types[s] = t;
|
||||||
|
}
|
||||||
65
code/compiler/09/type.hpp
Normal file
65
code/compiler/09/type.hpp
Normal file
@@ -0,0 +1,65 @@
|
|||||||
|
#pragma once
|
||||||
|
#include <memory>
|
||||||
|
#include <map>
|
||||||
|
|
||||||
|
struct type_mgr;
|
||||||
|
|
||||||
|
struct type {
|
||||||
|
virtual ~type() = default;
|
||||||
|
|
||||||
|
virtual void print(const type_mgr& mgr, std::ostream& to) const = 0;
|
||||||
|
};
|
||||||
|
|
||||||
|
using type_ptr = std::shared_ptr<type>;
|
||||||
|
|
||||||
|
struct type_var : public type {
|
||||||
|
std::string name;
|
||||||
|
|
||||||
|
type_var(std::string n)
|
||||||
|
: name(std::move(n)) {}
|
||||||
|
|
||||||
|
void print(const type_mgr& mgr, std::ostream& to) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct type_base : public type {
|
||||||
|
std::string name;
|
||||||
|
|
||||||
|
type_base(std::string n)
|
||||||
|
: name(std::move(n)) {}
|
||||||
|
|
||||||
|
void print(const type_mgr& mgr, std::ostream& to) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct type_data : public type_base {
|
||||||
|
struct constructor {
|
||||||
|
int tag;
|
||||||
|
};
|
||||||
|
|
||||||
|
std::map<std::string, constructor> constructors;
|
||||||
|
|
||||||
|
type_data(std::string n)
|
||||||
|
: type_base(std::move(n)) {}
|
||||||
|
};
|
||||||
|
|
||||||
|
struct type_arr : public type {
|
||||||
|
type_ptr left;
|
||||||
|
type_ptr right;
|
||||||
|
|
||||||
|
type_arr(type_ptr l, type_ptr r)
|
||||||
|
: left(std::move(l)), right(std::move(r)) {}
|
||||||
|
|
||||||
|
void print(const type_mgr& mgr, std::ostream& to) const;
|
||||||
|
};
|
||||||
|
|
||||||
|
struct type_mgr {
|
||||||
|
int last_id = 0;
|
||||||
|
std::map<std::string, type_ptr> types;
|
||||||
|
|
||||||
|
std::string new_type_name();
|
||||||
|
type_ptr new_type();
|
||||||
|
type_ptr new_arrow_type();
|
||||||
|
|
||||||
|
void unify(type_ptr l, type_ptr r);
|
||||||
|
type_ptr resolve(type_ptr t, type_var*& var) const;
|
||||||
|
void bind(const std::string& s, type_ptr t);
|
||||||
|
};
|
||||||
16
code/compiler/09/type_env.cpp
Normal file
16
code/compiler/09/type_env.cpp
Normal file
@@ -0,0 +1,16 @@
|
|||||||
|
#include "type_env.hpp"
|
||||||
|
|
||||||
|
type_ptr type_env::lookup(const std::string& name) const {
|
||||||
|
auto it = names.find(name);
|
||||||
|
if(it != names.end()) return it->second;
|
||||||
|
if(parent) return parent->lookup(name);
|
||||||
|
return nullptr;
|
||||||
|
}
|
||||||
|
|
||||||
|
void type_env::bind(const std::string& name, type_ptr t) {
|
||||||
|
names[name] = t;
|
||||||
|
}
|
||||||
|
|
||||||
|
type_env type_env::scope() const {
|
||||||
|
return type_env(this);
|
||||||
|
}
|
||||||
16
code/compiler/09/type_env.hpp
Normal file
16
code/compiler/09/type_env.hpp
Normal file
@@ -0,0 +1,16 @@
|
|||||||
|
#pragma once
|
||||||
|
#include <map>
|
||||||
|
#include "type.hpp"
|
||||||
|
|
||||||
|
struct type_env {
|
||||||
|
std::map<std::string, type_ptr> names;
|
||||||
|
type_env const* parent = nullptr;
|
||||||
|
|
||||||
|
type_env(type_env const* p)
|
||||||
|
: parent(p) {}
|
||||||
|
type_env() : type_env(nullptr) {}
|
||||||
|
|
||||||
|
type_ptr lookup(const std::string& name) const;
|
||||||
|
void bind(const std::string& name, type_ptr t);
|
||||||
|
type_env scope() const;
|
||||||
|
};
|
||||||
119
code/cs325-langs/hws/hw1.txt
Normal file
119
code/cs325-langs/hws/hw1.txt
Normal file
@@ -0,0 +1,119 @@
|
|||||||
|
CS 325-001, Analysis of Algorithms, Fall 2019
|
||||||
|
HW1 - Python 3, qsort, BST, and qselect
|
||||||
|
Due electronically on flip on Monday 9/30 at 11:59pm.
|
||||||
|
No late submission will be accepted.
|
||||||
|
|
||||||
|
Need to submit on flip: report.txt, qsort.py, and qselect.py.
|
||||||
|
qselect.py will be automatically graded for correctness (1%).
|
||||||
|
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw1 qselect.py qsort.py report.txt
|
||||||
|
|
||||||
|
Note:
|
||||||
|
|
||||||
|
1. You can ssh to flip machines from your own machine by:
|
||||||
|
$ ssh access.engr.oregonstate.edu
|
||||||
|
|
||||||
|
2. You can add /nfs/farm/classes/eecs/fall2019/cs325-001/ to your $PATH:
|
||||||
|
$ export PATH=$PATH:/nfs/farm/classes/eecs/fall2019/cs325-001/
|
||||||
|
and add the above command to your ~/.bash_profile,
|
||||||
|
so that you don't need to type it every time.
|
||||||
|
|
||||||
|
(alternatively, you can use symbolic links or aliases to avoid typing the long path)
|
||||||
|
|
||||||
|
3. You can choose to submit each file separately, or submit them together.
|
||||||
|
|
||||||
|
Textbooks for References:
|
||||||
|
[1] CLRS Ch. 9.2 and Ch. 12
|
||||||
|
|
||||||
|
0. Q: What's the best-case, worst-case, and average-case time complexities of quicksort.
|
||||||
|
Briefly explain each case.
|
||||||
|
|
||||||
|
1. [WILL BE GRADED]
|
||||||
|
Quickselect with Randomized Pivot (CLRS Ch. 9.2).
|
||||||
|
|
||||||
|
>>> from qselect import *
|
||||||
|
>>> qselect(2, [3, 10, 4, 7, 19])
|
||||||
|
4
|
||||||
|
>>> qselect(4, [11, 2, 8, 3])
|
||||||
|
11
|
||||||
|
|
||||||
|
Q: What's the best-case, worst-case, and average-case time complexities? Briefly explain.
|
||||||
|
|
||||||
|
Filename: qselect.py
|
||||||
|
|
||||||
|
|
||||||
|
2. Buggy Qsort Revisited
|
||||||
|
|
||||||
|
In the slides we showed a buggy version of qsort which is weird in an interesting way:
|
||||||
|
it actually returns a binary search tree for the given array, rooted at the pivot:
|
||||||
|
|
||||||
|
>>> from qsort import *
|
||||||
|
>>> tree = sort([4,2,6,3,5,7,1,9])
|
||||||
|
>>> tree
|
||||||
|
[[[[], 1, []], 2, [[], 3, []]], 4, [[[], 5, []], 6, [[], 7, [[], 9, []]]]]
|
||||||
|
|
||||||
|
which encodes a binary search tree:
|
||||||
|
|
||||||
|
4
|
||||||
|
/ \
|
||||||
|
2 6
|
||||||
|
/ \ / \
|
||||||
|
1 3 5 7
|
||||||
|
\
|
||||||
|
9
|
||||||
|
|
||||||
|
Now on top of that piece of code, add three functions:
|
||||||
|
* sorted(t): returns the sorted order (infix traversal)
|
||||||
|
* search(t, x): returns whether x is in t
|
||||||
|
* insert(t, x): inserts x into t (in-place) if it is missing, otherwise does nothing.
|
||||||
|
|
||||||
|
>>> sorted(tree)
|
||||||
|
[1, 2, 3, 4, 5, 6, 7, 9]
|
||||||
|
>>> search(tree, 6)
|
||||||
|
True
|
||||||
|
>>> search(tree, 6.5)
|
||||||
|
False
|
||||||
|
>>> insert(tree, 6.5)
|
||||||
|
>>> tree
|
||||||
|
[[[[], 1, []], 2, [[], 3, []]], 4, [[[], 5, []], 6, [[[], 6.5, []], 7, [[], 9, []]]]]
|
||||||
|
>>> insert(tree, 3)
|
||||||
|
>>> tree
|
||||||
|
[[[[], 1, []], 2, [[], 3, []]], 4, [[[], 5, []], 6, [[[], 6.5, []], 7, [[], 9, []]]]]
|
||||||
|
|
||||||
|
Hint: both search and insert should depend on a helper function _search(tree, x) which
|
||||||
|
returns the subtree (a list) rooted at x when x is found, or the [] where x should
|
||||||
|
be inserted.
|
||||||
|
|
||||||
|
e.g.,
|
||||||
|
>>> tree = sort([4,2,6,3,5,7,1,9]) # starting from the initial tree
|
||||||
|
>>> _search(tree, 3)
|
||||||
|
[[], 3, []]
|
||||||
|
>>> _search(tree, 0)
|
||||||
|
[]
|
||||||
|
>>> _search(tree, 6.5)
|
||||||
|
[]
|
||||||
|
>>> _search(tree, 0) is _search(tree, 6.5)
|
||||||
|
False
|
||||||
|
>>> _search(tree, 0) == _search(tree, 6.5)
|
||||||
|
True
|
||||||
|
|
||||||
|
Note the last two []'s are different nodes (with different memory addresses):
|
||||||
|
the first one is the left child of 1, while the second one is the left child of 7
|
||||||
|
(so that insert is very easy).
|
||||||
|
|
||||||
|
Filename: qsort.py
|
||||||
|
|
||||||
|
Q: What are the time complexities for the operations implemented?
|
||||||
|
|
||||||
|
Debriefing (required!): --------------------------
|
||||||
|
|
||||||
|
1. Approximately how many hours did you spend on this assignment?
|
||||||
|
2. Would you rate it as easy, moderate, or difficult?
|
||||||
|
3. Did you work on it mostly alone, or mostly with other people?
|
||||||
|
4. How deeply do you feel you understand the material it covers (0%–100%)?
|
||||||
|
5. Any other comments?
|
||||||
|
|
||||||
|
This section is intended to help us calibrate the homework assignments.
|
||||||
|
Your answers to this section will *not* affect your grade; however, skipping it
|
||||||
|
will certainly do.
|
||||||
|
|
||||||
170
code/cs325-langs/hws/hw10.txt
Normal file
170
code/cs325-langs/hws/hw10.txt
Normal file
@@ -0,0 +1,170 @@
|
|||||||
|
CS 325, Algorithms (MS/MEng-level), Fall 2019
|
||||||
|
|
||||||
|
HW10 - Challenge Problem - RNA Structure Prediction (6%)
|
||||||
|
This problem combines dynamic programming and priority queues.
|
||||||
|
|
||||||
|
Due Wednesday 12/4, 11:59pm.
|
||||||
|
No late submission will be accepted.
|
||||||
|
|
||||||
|
Include in your submission: report.txt, rna.py.
|
||||||
|
Grading:
|
||||||
|
* report.txt -- 1%
|
||||||
|
* 1-best structure -- 2%
|
||||||
|
* number of structures -- 1%
|
||||||
|
* k-best structures -- 2%
|
||||||
|
|
||||||
|
Textbooks for References:
|
||||||
|
[1] KT Ch. 6.5 (DP over intervals -- RNA structure)
|
||||||
|
[2] KT slides: DP I (RNA section)
|
||||||
|
http://www.cs.princeton.edu/~wayne/kleinberg-tardos/
|
||||||
|
|
||||||
|
***Please analyze time/space complexities for each problem in report.txt.
|
||||||
|
|
||||||
|
1. Given an RNA sequence, such as ACAGU, we can predict its secondary structure
|
||||||
|
by tagging each nucleotide as (, ., or ). Each matching pair of () must be
|
||||||
|
AU, GC, or GU (or their mirror symmetries: UA, CG, UG).
|
||||||
|
We also assume pairs can _not_ cross each other.
|
||||||
|
The following are valid structures for ACAGU:
|
||||||
|
|
||||||
|
ACAGU
|
||||||
|
.....
|
||||||
|
...()
|
||||||
|
..(.)
|
||||||
|
.(.).
|
||||||
|
(...)
|
||||||
|
((.))
|
||||||
|
|
||||||
|
We want to find the structure with the maximum number of matching pairs.
|
||||||
|
In the above example, the last structure is optimal (2 pairs).
|
||||||
|
|
||||||
|
>>> best("ACAGU")
|
||||||
|
(2, '((.))')
|
||||||
|
|
||||||
|
Tie-breaking: arbitrary. Don't worry as long as your structure
|
||||||
|
is one of the correct best structures.
|
||||||
|
|
||||||
|
some other cases (more cases at the bottom):
|
||||||
|
|
||||||
|
GCACG
|
||||||
|
(2, '().()')
|
||||||
|
UUCAGGA
|
||||||
|
(3, '(((.)))')
|
||||||
|
GUUAGAGUCU
|
||||||
|
(4, '(.()((.)))')
|
||||||
|
AUAACCUUAUAGGGCUCUG
|
||||||
|
(8, '.(((..)()()((()))))')
|
||||||
|
AACCGCUGUGUCAAGCCCAUCCUGCCUUGUU
|
||||||
|
(11, '(((.(..(.((.)((...().))()))))))')
|
||||||
|
GAUGCCGUGUAGUCCAAAGACUUCACCGUUGG
|
||||||
|
(14, '.()()(()(()())(((.((.)(.))()))))')
|
||||||
|
CAUCGGGGUCUGAGAUGGCCAUGAAGGGCACGUACUGUUU
|
||||||
|
(18, '(()())(((((.)))()(((())(.(.().()()))))))')
|
||||||
|
ACGGCCAGUAAAGGUCAUAUACGCGGAAUGACAGGUCUAUCUAC
|
||||||
|
(19, '.()(((.)(..))(((.()()(())))(((.)((())))))())')
|
||||||
|
AGGCAUCAAACCCUGCAUGGGAGCACCGCCACUGGCGAUUUUGGUA
|
||||||
|
(20, '.(()())...((((()()))((()(.()(((.)))()())))))()')
|
||||||
|
|
||||||
|
2. Total number of all possible structures
|
||||||
|
|
||||||
|
>>> total("ACAGU")
|
||||||
|
6
|
||||||
|
|
||||||
|
3. k-best structures: output the 1-best, 2nd-best, ... kth-best structures.
|
||||||
|
|
||||||
|
>>> kbest("ACAGU", 3)
|
||||||
|
[(2, '((.))'), (1, '(...)'), (1, '.(.).')]
|
||||||
|
|
||||||
|
The list must be sorted.
|
||||||
|
Tie-breaking: arbitrary.
|
||||||
|
|
||||||
|
In case the input k is bigger than the number of possible structures, output all.
|
||||||
|
|
||||||
|
Sanity check: kbest(s, 1)[0][0] == best(s)[0] for each RNA sequence s.
|
||||||
|
|
||||||
|
All three functions should be in one file: rna.py.
|
||||||
|
|
||||||
|
See more testcases at the end.
|
||||||
|
|
||||||
|
Debriefing (required!): --------------------------
|
||||||
|
|
||||||
|
0. What's your name?
|
||||||
|
1. Approximately how many hours did you spend on this assignment?
|
||||||
|
2. Would you rate it as easy, moderate, or difficult?
|
||||||
|
3. Did you work on it mostly alone, or mostly with other people?
|
||||||
|
4. How deeply do you feel you understand the material it covers (0%-100%)?
|
||||||
|
5. Any other comments?
|
||||||
|
|
||||||
|
This section is intended to help us calibrate the homework assignments.
|
||||||
|
Your answers to this section will *not* affect your grade; however, skipping it
|
||||||
|
will certainly do.
|
||||||
|
|
||||||
|
|
||||||
|
TESTCASES:
|
||||||
|
|
||||||
|
for each sequence s, we list three lines:
|
||||||
|
best(s)
|
||||||
|
total(s)
|
||||||
|
kbest(s, 10)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
ACAGU
|
||||||
|
(2, '((.))')
|
||||||
|
6
|
||||||
|
[(2, '((.))'), (1, '.(.).'), (1, '..(.)'), (1, '...()'), (1, '(...)'), (0, '.....')]
|
||||||
|
------
|
||||||
|
AC
|
||||||
|
(0, '..')
|
||||||
|
1
|
||||||
|
[(0, '..')]
|
||||||
|
------
|
||||||
|
GUAC
|
||||||
|
(2, '(())')
|
||||||
|
5
|
||||||
|
[(2, '(())'), (1, '()..'), (1, '.().'), (1, '(..)'), (0, '....')]
|
||||||
|
------
|
||||||
|
GCACG
|
||||||
|
(2, '().()')
|
||||||
|
6
|
||||||
|
[(2, '().()'), (1, '(..).'), (1, '()...'), (1, '.(..)'), (1, '...()'), (0, '.....')]
|
||||||
|
------
|
||||||
|
CCGG
|
||||||
|
(2, '(())')
|
||||||
|
6
|
||||||
|
[(2, '(())'), (1, '(.).'), (1, '.().'), (1, '.(.)'), (1, '(..)'), (0, '....')]
|
||||||
|
------
|
||||||
|
CCCGGG
|
||||||
|
(3, '((()))')
|
||||||
|
20
|
||||||
|
[(3, '((()))'), (2, '((.)).'), (2, '(.()).'), (2, '.(()).'), (2, '.(().)'), (2, '.((.))'), (2, '((.).)'), (2, '(.(.))'), (2, '(.().)'), (2, '((..))')]
|
||||||
|
------
|
||||||
|
UUCAGGA
|
||||||
|
(3, '(((.)))')
|
||||||
|
24
|
||||||
|
[(3, '(((.)))'), (2, '((.).).'), (2, '((..)).'), (2, '(.(.)).'), (2, '((.))..'), (2, '.((.)).'), (2, '.((.).)'), (2, '.((..))'), (2, '((..).)'), (2, '((.)..)')]
|
||||||
|
------
|
||||||
|
AUAACCUA
|
||||||
|
(2, '.((...))')
|
||||||
|
19
|
||||||
|
[(2, '((.)..).'), (2, '(()...).'), (2, '()(...).'), (2, '().(..).'), (2, '()....()'), (2, '.()(..).'), (2, '.()...()'), (2, '.(.)..()'), (2, '.((...))'), (2, '.(.(..))')]
|
||||||
|
------
|
||||||
|
UUGGACUUG
|
||||||
|
(4, '(()((.)))')
|
||||||
|
129
|
||||||
|
[(4, '(())(.)()'), (4, '(()((.)))'), (3, '(().)..()'), (3, '(().).(.)'), (3, '(().)(..)'), (3, '((.))..()'), (3, '((.)).(.)'), (3, '((.))(..)'), (3, '(())(..).'), (3, '(())(.)..')]
|
||||||
|
------
|
||||||
|
UUUGGCACUA
|
||||||
|
(4, '(.()()(.))')
|
||||||
|
179
|
||||||
|
[(4, '((()).).()'), (4, '((.)()).()'), (4, '(.()()).()'), (4, '.(()()).()'), (4, '.(()()(.))'), (4, '((()).(.))'), (4, '((.)()(.))'), (4, '((()())..)'), (4, '(.()()(.))'), (3, '((()).)...')]
|
||||||
|
------
|
||||||
|
GAUGCCGUGUAGUCCAAAGACUUC
|
||||||
|
(11, '(((()()((()(.))))((.))))')
|
||||||
|
2977987
|
||||||
|
[(11, '(()())(((()().))(((.))))'), (11, '(()())(((()()).)(((.))))'), (11, '(()())(((()(.)))(((.))))'), (11, '(()()()((()(.)))(((.))))'), (11, '(((()()((()().)))((.))))'), (11, '(((()()((()(.))))((.))))'), (11, '(()()()((()()).)(((.))))'), (11, '(()()()((()().))(((.))))'), (11, '(((()()((()()).))((.))))'), (10, '(()()()((()().).)((.))).')]
|
||||||
|
------
|
||||||
|
AGGCAUCAAACCCUGCAUGGGAGCG
|
||||||
|
(10, '.(()())...((((()()))).())')
|
||||||
|
560580
|
||||||
|
[(10, '.(()())...((((())())).)()'), (10, '.(()())...((((()()))).)()'), (10, '.(()())...(((()(()))).)()'), (10, '.(()())...(((()(()))).())'), (10, '.(()())...((((())())).())'), (10, '.(()())...((((()()))).())'), (9, '((.).)(...(.((()()))).)()'), (9, '((.).)(...(((.)(()))).)()'), (9, '((.).)(...(.(()(()))).)()'), (9, '((.).)(...((.(()()))).)()')]
|
||||||
|
------
|
||||||
42
code/cs325-langs/hws/hw11.txt
Normal file
42
code/cs325-langs/hws/hw11.txt
Normal file
@@ -0,0 +1,42 @@
|
|||||||
|
HW11 -- OPTIONAL (for your practice only -- solutions will be released on Tuesday)
|
||||||
|
|
||||||
|
Edit Distance (see updated final review solutions)
|
||||||
|
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw11 edit.py
|
||||||
|
|
||||||
|
Implement two functions:
|
||||||
|
* distance1(s, t): Viterbi-style (either top-down or bottom-up)
|
||||||
|
* distance2(s, t): Dijkstra-style (best-first)
|
||||||
|
|
||||||
|
For Dijkstra, you can use either heapdict or heapq (see review problem 7).
|
||||||
|
Given that this graph is extremely sparse (why?), heapq (ElogE) might be faster than heapdict (ElogV)
|
||||||
|
because the latter has overhead for hash.
|
||||||
|
|
||||||
|
They should return the same result (just return the edit distance).
|
||||||
|
|
||||||
|
We have 10 testcases (listed below); the first 5 test distance1(),
|
||||||
|
and the second 5 test distance2() on the same 5 string pairs.
|
||||||
|
|
||||||
|
My solutions (on flip2):
|
||||||
|
Testing Case 1 (open)... 0.001 s, Correct
|
||||||
|
Testing Case 2 (open)... 0.000 s, Correct
|
||||||
|
Testing Case 3 (open)... 0.012 s, Correct
|
||||||
|
Testing Case 4 (open)... 0.155 s, Correct
|
||||||
|
Testing Case 5 (open)... 0.112 s, Correct
|
||||||
|
Testing Case 6 (hidden)... 0.000 s, Correct
|
||||||
|
Testing Case 7 (hidden)... 0.000 s, Correct
|
||||||
|
Testing Case 8 (hidden)... 0.004 s, Correct
|
||||||
|
Testing Case 9 (hidden)... 0.009 s, Correct
|
||||||
|
Testing Case 10 (hidden)... 0.021 s, Correct
|
||||||
|
Total Time: 0.316 s
|
||||||
|
|
||||||
|
distance1("abcdefh", "abbcdfg") == 3
|
||||||
|
distance1("pretty", "prettier") == 3
|
||||||
|
distance1("aaaaaaadaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "aaaaaaaaaaaabaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxaaaaaaaaaaaaaaaaaaaaaa") == 5
|
||||||
|
distance1('cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbxtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfjbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwy', 'cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasonrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwy') == 3
|
||||||
|
distance1('cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpasdfkecyywrbvhlqgxzutdjfmvlhsezfbhbllmfhzlqlcwibubyyjupbwhztsxyksfthkptxqlmhivfjbgclhombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrttoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwydmbihjkvziitusmkjljrsbafytsinql', 'cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfjbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwydmbihjkvziitusmkjljrsbafytsinql') == 11
|
||||||
|
distance2("abcdefh", "abbcdfg") == 3
|
||||||
|
distance2("pretty", "prettier") == 3
|
||||||
|
distance2("aaaaaaadaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "aaaaaaaaaaaabaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxaaaaaaaaaaaaaaaaaaaaaa") == 5
|
||||||
|
distance2('cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbxtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfjbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwy', 'cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasonrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwy') == 3
|
||||||
|
distance2('cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpasdfkecyywrbvhlqgxzutdjfmvlhsezfbhbllmfhzlqlcwibubyyjupbwhztsxyksfthkptxqlmhivfjbgclhombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrttoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwydmbihjkvziitusmkjljrsbafytsinql', 'cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfjbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwydmbihjkvziitusmkjljrsbafytsinql') == 11
|
||||||
80
code/cs325-langs/hws/hw2.txt
Normal file
80
code/cs325-langs/hws/hw2.txt
Normal file
@@ -0,0 +1,80 @@
|
|||||||
|
CS 325-001, Analysis of Algorithms, Fall 2019
|
||||||
|
HW2 - Divide-n-conquer: mergesort, number of inversions, longest path
|
||||||
|
|
||||||
|
Due Monday Oct 7, 11:59pm (same submission instructions as HW1).
|
||||||
|
No late submission will be accepted.
|
||||||
|
|
||||||
|
Need to submit: report.txt, msort.py, inversions.py, and longest.py.
|
||||||
|
longest.py will be graded for correctness (1%).
|
||||||
|
|
||||||
|
To submit:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw2 report.txt {msort,inversions,longest}.py
|
||||||
|
(You can submit each file separately, or submit them together.)
|
||||||
|
|
||||||
|
To see your best results so far:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw2
|
||||||
|
|
||||||
|
|
||||||
|
Textbooks for References:
|
||||||
|
[1] CLRS Ch. 2
|
||||||
|
|
||||||
|
0. Which of the following sorting algorithms are (or can be made) stable?
|
||||||
|
(a) mergesort
|
||||||
|
(b) quicksort with the first element as pivot
|
||||||
|
(c) quicksort with randomized pivot
|
||||||
|
(d) selection sort
|
||||||
|
(e) insertion sort
|
||||||
|
(f) heap sort --- not covered yet (see CLRS Ch. 6)
|
||||||
|
|
||||||
|
1. Implement mergesort.
|
||||||
|
|
||||||
|
>>> mergesort([4, 2, 5, 1, 6, 3])
|
||||||
|
[1, 2, 3, 4, 5, 6]
|
||||||
|
|
||||||
|
Filename: msort.py
|
||||||
|
|
||||||
|
2. Calculate the number of inversions in a list.
|
||||||
|
|
||||||
|
>>> num_inversions([4, 1, 3, 2])
|
||||||
|
4
|
||||||
|
>>> num_inversions([2, 4, 1, 3])
|
||||||
|
3
|
||||||
|
|
||||||
|
Filename: inversions.py
|
||||||
|
Must run in O(nlogn) time.
|
||||||
|
|
||||||
|
3. [WILL BE GRADED]
|
||||||
|
|
||||||
|
Length of the longest path in a binary tree (number of edges).
|
||||||
|
|
||||||
|
We will use the "buggy qsort" representation of binary trees from HW1:
|
||||||
|
[left_subtree, root, right_subtree]
|
||||||
|
|
||||||
|
>>> longest([[], 1, []])
|
||||||
|
0
|
||||||
|
|
||||||
|
>>> longest([[[], 1, []], 2, [[], 3, []]])
|
||||||
|
2
|
||||||
|
|
||||||
|
>>> longest([[[[], 1, []], 2, [[], 3, []]], 4, [[[], 5, []], 6, [[], 7, [[], 9, []]]]])
|
||||||
|
5
|
||||||
|
|
||||||
|
Note the answer is 5 because the longest path is 1-2-4-6-7-9.
|
||||||
|
|
||||||
|
Filename: longest.py
|
||||||
|
Must run in O(n) time.
|
||||||
|
|
||||||
|
Debriefing (required!): --------------------------
|
||||||
|
|
||||||
|
1. Approximately how many hours did you spend on this assignment?
|
||||||
|
2. Would you rate it as easy, moderate, or difficult?
|
||||||
|
3. Did you work on it mostly alone, or mostly with other people?
|
||||||
|
Note you are encouraged to discuss with your classmates,
|
||||||
|
but each students should submit his/her own code.
|
||||||
|
4. How deeply do you feel you understand the material it covers (0%–100%)?
|
||||||
|
5. Any other comments?
|
||||||
|
|
||||||
|
This section is intended to help us calibrate the homework assignments.
|
||||||
|
Your answers to this section will *not* affect your grade; however, skipping it
|
||||||
|
will certainly do.
|
||||||
|
|
||||||
83
code/cs325-langs/hws/hw3.txt
Normal file
83
code/cs325-langs/hws/hw3.txt
Normal file
@@ -0,0 +1,83 @@
|
|||||||
|
CS 325, Algorithms, Fall 2019
|
||||||
|
HW3 - K closest numbers; Two Pointers
|
||||||
|
|
||||||
|
Due Monday Oct 14, 11:59pm. (same submission instructions as HW1-2).
|
||||||
|
No late submission will be accepted.
|
||||||
|
|
||||||
|
Need to submit: report.txt, closest_unsorted.py, closest_sorted.py, xyz.py.
|
||||||
|
closest_sorted.py will be graded for correctness (1%).
|
||||||
|
|
||||||
|
To submit:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw3 report.txt {closest*,xyz}.py
|
||||||
|
(You can submit each file separately, or submit them together.)
|
||||||
|
|
||||||
|
To see your best results so far:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw3
|
||||||
|
|
||||||
|
|
||||||
|
1. Given an array A of n numbers, a query x, and a number k,
|
||||||
|
find the k numbers in A that are closest (in value) to x.
|
||||||
|
For example:
|
||||||
|
|
||||||
|
find([4,1,3,2,7,4], 5.2, 2) returns [4,4]
|
||||||
|
find([4,1,3,2,7,4], 6.5, 3) returns [4,7,4]
|
||||||
|
find([5,3,4,1,6,3], 3.5, 2) returns [3,4]
|
||||||
|
|
||||||
|
|
||||||
|
Filename: closest_unsorted.py
|
||||||
|
Must run in O(n) time.
|
||||||
|
The elements in the returned list must be in the original order.
|
||||||
|
In case two numbers are equally close to x, choose the earlier one.
|
||||||
|
|
||||||
|
|
||||||
|
2. [WILL BE GRADED]
|
||||||
|
Now what if the input array is sorted? Can you do it faster?
|
||||||
|
|
||||||
|
find([1,2,3,4,4,7], 5.2, 2) returns [4,4]
|
||||||
|
find([1,2,3,4,4,7], 6.5, 3) returns [4,4,7]
|
||||||
|
|
||||||
|
Filename: closest_sorted.py
|
||||||
|
Must run in O(logn + k) time.
|
||||||
|
The elements in the returned list must be in the original order.
|
||||||
|
|
||||||
|
Note: in case two numbers are equally close to x, choose the smaller one:
|
||||||
|
find([1,2,3,4,4,6,6], 5, 3) returns [4,4,6]
|
||||||
|
find([1,2,3,4,4,5,6], 4, 5) returns [2,3,4,4,5]
|
||||||
|
|
||||||
|
Hint: you can use Python's bisect.bisect for binary search.
|
||||||
|
|
||||||
|
|
||||||
|
3. For a given array A of n *distinct* numbers, find all triples (x,y,z)
|
||||||
|
s.t. x + y = z. (x, y, z are distinct numbers)
|
||||||
|
|
||||||
|
e.g.,
|
||||||
|
|
||||||
|
find([1, 4, 2, 3, 5]) returns [(1,3,4), (1,2,3), (1,4,5), (2,3,5)]
|
||||||
|
|
||||||
|
Note that:
|
||||||
|
1) no duplicates in the input array
|
||||||
|
2) you can choose any arbitrary order for triples in the returned list.
|
||||||
|
|
||||||
|
Filename: xyz.py
|
||||||
|
Must run in O(n^2) time.
|
||||||
|
|
||||||
|
Hint: you can use any built-in sort in Python.
|
||||||
|
|
||||||
|
|
||||||
|
Debriefing (required!): --------------------------
|
||||||
|
|
||||||
|
0. What's your name?
|
||||||
|
1. Approximately how many hours did you spend on this assignment?
|
||||||
|
2. Would you rate it as easy, moderate, or difficult?
|
||||||
|
3. Did you work on it mostly alone, or mostly with other people?
|
||||||
|
Note you are encouraged to discuss with your classmates,
|
||||||
|
but each students should submit his/her own code.
|
||||||
|
4. How deeply do you feel you understand the material it covers (0%-100%)?
|
||||||
|
|
||||||
|
5. Which part(s) of the course you like the most so far?
|
||||||
|
6. Which part(s) of the course you dislike the most so far?
|
||||||
|
|
||||||
|
This section is intended to help us calibrate the homework assignments.
|
||||||
|
Your answers to this section will *not* affect your grade; however, skipping it
|
||||||
|
will certainly do.
|
||||||
|
|
||||||
114
code/cs325-langs/hws/hw4.txt
Normal file
114
code/cs325-langs/hws/hw4.txt
Normal file
@@ -0,0 +1,114 @@
|
|||||||
|
CS 325-001, Algorithms, Fall 2019
|
||||||
|
HW4 - Priority Queue and Heaps
|
||||||
|
|
||||||
|
Due via the submit program on Monday Oct 21, 11:59pm.
|
||||||
|
No late submission will be accepted.
|
||||||
|
|
||||||
|
Need to submit: report.txt, nbest.py, kmergesort.py, datastream.py.
|
||||||
|
datastream.py will be graded for correctness (1%).
|
||||||
|
|
||||||
|
To submit:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw4 report.txt {nbest,kmergesort,datastream}.py
|
||||||
|
(You can submit each file separately, or submit them together.)
|
||||||
|
|
||||||
|
To see your best results so far:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw4
|
||||||
|
|
||||||
|
|
||||||
|
Textbooks for References:
|
||||||
|
[1] CLRS Ch. 6
|
||||||
|
[2] KT slides for binary heaps (only read the first 20 pages!):
|
||||||
|
https://www.cs.princeton.edu/~wayne/kleinberg-tardos/pdf/BinomialHeaps.pdf
|
||||||
|
[3] Python heapq module
|
||||||
|
|
||||||
|
0. There are two methods for building a heap from an unsorted array:
|
||||||
|
(1) insert each element into the heap --- O(nlogn) -- heapq.heappush()
|
||||||
|
(2) heapify (top-down) --- O(n) -- heapq.heapify()
|
||||||
|
|
||||||
|
(a) Derive these time complexities.
|
||||||
|
(b) Use a long list of random numbers to show the difference in time. (Hint: random.shuffle or random.sample)
|
||||||
|
(c) What about sorted or reversely-sorted numbers?
|
||||||
|
|
||||||
|
1. Given two lists A and B, each with n integers, return
|
||||||
|
a sorted list C that contains the smallest n elements from AxB:
|
||||||
|
|
||||||
|
AxB = { (x, y) | x in A, y in B }
|
||||||
|
|
||||||
|
i.e., AxB is the Cartesian Product of A and B.
|
||||||
|
|
||||||
|
ordering: (x,y) < (x',y') iff. x+y < x'+y' or (x+y==x'+y' and y<y')
|
||||||
|
|
||||||
|
You need to implement three algorithms and compare:
|
||||||
|
|
||||||
|
(a) enumerate all n^2 pairs, sort, and take top n.
|
||||||
|
(b) enumerate all n^2 pairs, but use qselect from hw1.
|
||||||
|
(c) Dijkstra-style best-first, only enumerate O(n) (at most 2n) pairs.
|
||||||
|
Hint: you can use Python's heapq module for priority queue.
|
||||||
|
|
||||||
|
Q: What are the time complexities of these algorithms?
|
||||||
|
|
||||||
|
>>> a, b = [4, 1, 5, 3], [2, 6, 3, 4]
|
||||||
|
>>> nbesta(a, b) # algorithm (a), slowest
|
||||||
|
[(1, 2), (1, 3), (3, 2), (1, 4)]
|
||||||
|
>>> nbestb(a, b) # algorithm (b), slow
|
||||||
|
[(1, 2), (1, 3), (3, 2), (1, 4)]
|
||||||
|
>>> nbestc(a, b) # algorithm (c), fast
|
||||||
|
[(1, 2), (1, 3), (3, 2), (1, 4)]
|
||||||
|
|
||||||
|
Filename: nbest.py
|
||||||
|
|
||||||
|
2. k-way mergesort (the classical mergesort is a special case where k=2).
|
||||||
|
|
||||||
|
>>> kmergesort([4,1,5,2,6,3,7,0], 3) # k=3
|
||||||
|
[0,1,2,3,4,5,6,7]
|
||||||
|
|
||||||
|
Q: What is the complexity? Write down the detailed analysis in report.txt.
|
||||||
|
|
||||||
|
Filename: kmergesort.py
|
||||||
|
|
||||||
|
3. [WILL BE GRADED]
|
||||||
|
|
||||||
|
Find the k smallest numbers in a data stream of length n (k<<n),
|
||||||
|
using only O(k) space (the stream itself might be too big to fit in memory).
|
||||||
|
|
||||||
|
>>> ksmallest(4, [10, 2, 9, 3, 7, 8, 11, 5, 7])
|
||||||
|
[2, 3, 5, 7]
|
||||||
|
>>> ksmallest(3, range(1000000, 0, -1))
|
||||||
|
[1, 2, 3]
|
||||||
|
|
||||||
|
Note:
|
||||||
|
a) it should work with both lists and lazy lists
|
||||||
|
b) the output list should be sorted
|
||||||
|
|
||||||
|
Q: What is your complexity? Write down the detailed analysis in report.txt.
|
||||||
|
|
||||||
|
Filename: datastream.py
|
||||||
|
|
||||||
|
[UPDATE] The built-in function heapq.nsmallest() is _not_ allowed for this problem.
|
||||||
|
The whole point is to implement it yourself. :)
|
||||||
|
|
||||||
|
|
||||||
|
4. (optional) Summarize the time complexities of the basic operations (push, pop-min, peak, heapify) for these implementations of priority queue:
|
||||||
|
|
||||||
|
(a) unsorted array
|
||||||
|
(b) sorted array (highest priority first)
|
||||||
|
(c) reversly sorted array (lowest priority first)
|
||||||
|
(d) linked list
|
||||||
|
(e) binary heap
|
||||||
|
|
||||||
|
Debriefing (required!): --------------------------
|
||||||
|
|
||||||
|
0. What's your name?
|
||||||
|
1. Approximately how many hours did you spend on this assignment?
|
||||||
|
2. Would you rate it as easy, moderate, or difficult?
|
||||||
|
3. Did you work on it mostly alone, or mostly with other people?
|
||||||
|
Note you are encouraged to discuss with your classmates,
|
||||||
|
but each students should submit his/her own code.
|
||||||
|
4. How deeply do you feel you understand the material it covers (0%-100%)?
|
||||||
|
5. Which part(s) of the course you like the most so far?
|
||||||
|
6. Which part(s) of the course you dislike the most so far?
|
||||||
|
|
||||||
|
This section is intended to help us calibrate the homework assignments.
|
||||||
|
Your answers to this section will *not* affect your grade; however, skipping it
|
||||||
|
will certainly do.
|
||||||
|
|
||||||
130
code/cs325-langs/hws/hw5.txt
Normal file
130
code/cs325-langs/hws/hw5.txt
Normal file
@@ -0,0 +1,130 @@
|
|||||||
|
CS 532-001, Algorithms, Fall 2019
|
||||||
|
HW5 - DP (part 1: simple)
|
||||||
|
|
||||||
|
HWs 5-7 are all on DPs.
|
||||||
|
|
||||||
|
Due Monday Oct 28, 11:59pm.
|
||||||
|
No late submission will be accepted.
|
||||||
|
|
||||||
|
Need to submit report.txt, mis.py, bsts.py, bitstrings.py.
|
||||||
|
mis.py will be graded for correctness (1%).
|
||||||
|
|
||||||
|
To submit:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw5 report.txt {mis,bsts,bitstrings}.py
|
||||||
|
(You can submit each file separately, or submit them together.)
|
||||||
|
|
||||||
|
To see your best results so far:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw5
|
||||||
|
|
||||||
|
|
||||||
|
Textbooks for References:
|
||||||
|
[1] CLRS Ch. 15
|
||||||
|
[2] KT Ch. 6
|
||||||
|
or Ch. 5 in a previous version:
|
||||||
|
http://cs.furman.edu/~chealy/cs361/kleinbergbook.pdf
|
||||||
|
|
||||||
|
Hint: Among the three coding questions, p3 is the easiest, and p1 is similar to p3.
|
||||||
|
You'll realize that both are very similar to p0 (Fibonacci).
|
||||||
|
p2 is slightly different from these, but still very easy.
|
||||||
|
|
||||||
|
0. (Optional) Is Fibonacci REALLY O(n)?
|
||||||
|
Hint: the value of f(n) itself grows exponentially.
|
||||||
|
|
||||||
|
1. [WILL BE GRADED]
|
||||||
|
Maximum Weighted Independent Set
|
||||||
|
|
||||||
|
[HINT] independent set is a set where no two numbers are neighbors in the original list.
|
||||||
|
see also https://en.wikipedia.org/wiki/Independent_set_(graph_theory)
|
||||||
|
|
||||||
|
input: a list of numbers (could be negative)
|
||||||
|
output: a pair of the max sum and the list of numbers chosen
|
||||||
|
|
||||||
|
>>> max_wis([7,8,5])
|
||||||
|
(12, [7,5])
|
||||||
|
|
||||||
|
>>> max_wis([-1,8,10])
|
||||||
|
(10, [10])
|
||||||
|
|
||||||
|
>>> max_wis([])
|
||||||
|
(0, [])
|
||||||
|
|
||||||
|
[HINT] if all numbers are negative, the optimal solution is 0,
|
||||||
|
since [] is an independent set according to the definition above.
|
||||||
|
|
||||||
|
>>> max_wis([-5, -1, -4])
|
||||||
|
(0, [])
|
||||||
|
|
||||||
|
Q: What's the complexity?
|
||||||
|
|
||||||
|
Include both top-down (max_wis()) and bottom-up (max_wis2()) solutions,
|
||||||
|
and make sure they produce exact same results.
|
||||||
|
We'll only grade the top-down version.
|
||||||
|
|
||||||
|
Tie-breaking: any best solution is considered correct.
|
||||||
|
|
||||||
|
Filename: mis.py
|
||||||
|
|
||||||
|
[HINT] you can also use the naive O(2^n) exhaustive search method to verify your answer.
|
||||||
|
|
||||||
|
|
||||||
|
2. Number of n-node BSTs
|
||||||
|
|
||||||
|
input: n
|
||||||
|
output: number of n-node BSTs
|
||||||
|
|
||||||
|
>>> bsts(2)
|
||||||
|
2
|
||||||
|
>>> bsts(3)
|
||||||
|
5
|
||||||
|
>>> bsts(5)
|
||||||
|
42
|
||||||
|
|
||||||
|
[HINT] There are two 2-node BSTs:
|
||||||
|
2 1
|
||||||
|
/ \
|
||||||
|
1 2
|
||||||
|
Note that all other 2-node BSTs are *isomorphic* to either one.
|
||||||
|
|
||||||
|
Qa: What's the complexity of this DP?
|
||||||
|
|
||||||
|
Qb: What's the name of this famous number series?
|
||||||
|
|
||||||
|
Feel free to use any implementation style.
|
||||||
|
|
||||||
|
Filename: bsts.py
|
||||||
|
|
||||||
|
3. Number of bit strings of length n that has
|
||||||
|
|
||||||
|
1) no two consecutive 0s.
|
||||||
|
2) two consecutive 0s.
|
||||||
|
|
||||||
|
>>> num_no(3)
|
||||||
|
5
|
||||||
|
>>> num_yes(3)
|
||||||
|
3
|
||||||
|
|
||||||
|
[HINT] There are three 3-bit 0/1-strings that have two consecutive 0s.
|
||||||
|
001 100 000
|
||||||
|
The other five 3-bit 0/1-strings have no two consecutive 0s:
|
||||||
|
010 011 101 110 111
|
||||||
|
|
||||||
|
Feel free to choose any implementation style.
|
||||||
|
|
||||||
|
Filename: bitstrings.py
|
||||||
|
|
||||||
|
[HINT] Like problem 1, you can also use the O(2^n) exhaustive search method to verify your answer.
|
||||||
|
|
||||||
|
|
||||||
|
Debriefing (required!): --------------------------
|
||||||
|
|
||||||
|
0. What's your name?
|
||||||
|
1. Approximately how many hours did you spend on this assignment?
|
||||||
|
2. Would you rate it as easy, moderate, or difficult?
|
||||||
|
3. Did you work on it mostly alone, or mostly with other people?
|
||||||
|
4. How deeply do you feel you understand the material it covers (0%-100%)?
|
||||||
|
5. Which part(s) of the course you like the most so far?
|
||||||
|
6. Which part(s) of the course you dislike the most so far?
|
||||||
|
|
||||||
|
This section is intended to help us calibrate the homework assignments.
|
||||||
|
Your answers to this section will *not* affect your grade; however, skipping it
|
||||||
|
will certainly do.
|
||||||
114
code/cs325-langs/hws/hw6.txt
Normal file
114
code/cs325-langs/hws/hw6.txt
Normal file
@@ -0,0 +1,114 @@
|
|||||||
|
CS 325-001, Algorithms, Fall 2019
|
||||||
|
HW6 - DP (part 2)
|
||||||
|
|
||||||
|
Due on Monday Nov 4, 11:59pm.
|
||||||
|
No late submission will be accepted.
|
||||||
|
|
||||||
|
Need to submit: report.txt, knapsack_unbounded.py, knapsack_bounded.py.
|
||||||
|
knapsack_bounded.py will be graded for correctness (1%).
|
||||||
|
|
||||||
|
To submit:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw6 report.txt knapsack*.py
|
||||||
|
(You can submit each file separately, or submit them together.)
|
||||||
|
|
||||||
|
To see your best results so far:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw6
|
||||||
|
|
||||||
|
Textbooks for References:
|
||||||
|
[1] KT Ch. 6.4
|
||||||
|
or Ch. 5.3 in a previous version:
|
||||||
|
http://cs.furman.edu/~chealy/cs361/kleinbergbook.pdf
|
||||||
|
[2] KT slides for DP (pages 1-37):
|
||||||
|
https://www.cs.princeton.edu/~wayne/kleinberg-tardos/pdf/06DynamicProgrammingI.pdf
|
||||||
|
[3] Wikipedia: Knapsack (unbounded and 0/1)
|
||||||
|
[4] CLRS Ch. 15
|
||||||
|
|
||||||
|
Please answer time/space complexities for each problem in report.txt.
|
||||||
|
|
||||||
|
0. For each of the coding problems below:
|
||||||
|
(a) Describe a greedy solution.
|
||||||
|
(b) Show a counterexample to the greedy solution.
|
||||||
|
(c) Define the DP subproblem
|
||||||
|
(d) Write the recurrence relations
|
||||||
|
(e) Do not forget base cases
|
||||||
|
(f) Analyze the space and time complexities
|
||||||
|
|
||||||
|
1. Unbounded Knapsack
|
||||||
|
|
||||||
|
You have n items, each with weight w_i and value v_i, and each has infinite copies.
|
||||||
|
**All numbers are positive integers.**
|
||||||
|
What's the best value for a bag of W?
|
||||||
|
|
||||||
|
>>> best(3, [(2, 4), (3, 5)])
|
||||||
|
(5, [0, 1])
|
||||||
|
|
||||||
|
the input to the best() function is W and a list of pairs (w_i, v_i).
|
||||||
|
this output means to take 0 copies of item 1 and 1 copy of item 2.
|
||||||
|
|
||||||
|
tie-breaking: *reverse* lexicographical: i.e., [1, 0] is better than [0, 1]:
|
||||||
|
(i.e., take as many copies from the first item as possible, etc.)
|
||||||
|
|
||||||
|
>>> best(3, [(1, 5), (1, 5)])
|
||||||
|
(15, [3, 0])
|
||||||
|
|
||||||
|
>>> best(3, [(1, 2), (1, 5)])
|
||||||
|
(15, [0, 3])
|
||||||
|
|
||||||
|
>>> best(3, [(1, 2), (2, 5)])
|
||||||
|
(7, [1, 1])
|
||||||
|
|
||||||
|
>>> best(58, [(5, 9), (9, 18), (6, 12)])
|
||||||
|
(114, [2, 4, 2])
|
||||||
|
|
||||||
|
>>> best(92, [(8, 9), (9, 10), (10, 12), (5, 6)])
|
||||||
|
(109, [1, 1, 7, 1])
|
||||||
|
|
||||||
|
Q: What are the time and space complexities?
|
||||||
|
|
||||||
|
filename: knapsack_unbounded.py
|
||||||
|
|
||||||
|
2. [WILL BE GRADED]
|
||||||
|
Bounded Knapsack
|
||||||
|
|
||||||
|
You have n items, each with weight w_i and value v_i, and has c_i copies.
|
||||||
|
**All numbers are positive integers.**
|
||||||
|
What's the best value for a bag of W?
|
||||||
|
|
||||||
|
>>> best(3, [(2, 4, 2), (3, 5, 3)])
|
||||||
|
(5, [0, 1])
|
||||||
|
|
||||||
|
the input to the best() function is W and a list of triples (w_i, v_i, c_i).
|
||||||
|
|
||||||
|
tie-breaking: same as in p1:
|
||||||
|
|
||||||
|
>>> best(3, [(1, 5, 2), (1, 5, 3)])
|
||||||
|
(15, [2, 1])
|
||||||
|
|
||||||
|
>>> best(3, [(1, 5, 1), (1, 5, 3)])
|
||||||
|
(15, [1, 2])
|
||||||
|
|
||||||
|
>>> best(20, [(1, 10, 6), (3, 15, 4), (2, 10, 3)])
|
||||||
|
(130, [6, 4, 1])
|
||||||
|
|
||||||
|
>>> best(92, [(1, 6, 6), (6, 15, 7), (8, 9, 8), (2, 4, 7), (2, 20, 2)])
|
||||||
|
(236, [6, 7, 3, 7, 2])
|
||||||
|
|
||||||
|
Q: What are the time and space complexities?
|
||||||
|
|
||||||
|
filename: knapsack_bounded.py
|
||||||
|
|
||||||
|
You are encouraged to come up with a few other testcases yourself to test your code!
|
||||||
|
|
||||||
|
Debriefing (required!): --------------------------
|
||||||
|
|
||||||
|
0. What's your name?
|
||||||
|
1. Approximately how many hours did you spend on this assignment?
|
||||||
|
2. Would you rate it as easy, moderate, or difficult?
|
||||||
|
3. Did you work on it mostly alone, or mostly with other people?
|
||||||
|
4. How deeply do you feel you understand the material it covers (0%-100%)?
|
||||||
|
5. Which part(s) of the course you like the most so far?
|
||||||
|
6. Which part(s) of the course you dislike the most so far?
|
||||||
|
|
||||||
|
This section is intended to help us calibrate the homework assignments.
|
||||||
|
Your answers to this section will *not* affect your grade; however, skipping it
|
||||||
|
will certainly do.
|
||||||
147
code/cs325-langs/hws/hw8.txt
Normal file
147
code/cs325-langs/hws/hw8.txt
Normal file
@@ -0,0 +1,147 @@
|
|||||||
|
CS 325-001, Algorithms, Fall 2019
|
||||||
|
HW8 - Graphs (part I); DP (part III)
|
||||||
|
|
||||||
|
Due on Monday November 18, 11:59pm.
|
||||||
|
No late submission will be accepted.
|
||||||
|
|
||||||
|
Include in your submission: report.txt, topol.py, viterbi.py.
|
||||||
|
viterbi.py will be graded for correctness (1%).
|
||||||
|
|
||||||
|
To submit:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw8 report.txt {topol,viterbi}.py
|
||||||
|
(You can submit each file separately, or submit them together.)
|
||||||
|
|
||||||
|
To see your best results so far:
|
||||||
|
flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw8
|
||||||
|
|
||||||
|
Textbooks for References:
|
||||||
|
[1] CLRS Ch. 23 (Elementary Graph Algorithms)
|
||||||
|
[2] KT Ch. 3 (graphs), or Ch. 2 in this earlier version:
|
||||||
|
http://cs.furman.edu/~chealy/cs361/kleinbergbook.pdf
|
||||||
|
[3] KT slides (highly recommend!):
|
||||||
|
https://www.cs.princeton.edu/~wayne/kleinberg-tardos/pdf/03Graphs.pdf
|
||||||
|
[4] Jeff Erickson: Ch. 5 (Basic Graph Algorithms):
|
||||||
|
http://jeffe.cs.illinois.edu/teaching/algorithms/book/05-graphs.pdf
|
||||||
|
[5] DPV Ch. 3, 4.2, 4.4, 4.7 (Dasgupta, Papadimitriou, Vazirani)
|
||||||
|
https://www.cs.berkeley.edu/~vazirani/algorithms/chap3.pdf (decomposition of graphs)
|
||||||
|
https://www.cs.berkeley.edu/~vazirani/algorithms/chap4.pdf (paths, shortest paths)
|
||||||
|
[6] my advanced DP tutorial (up to page 16):
|
||||||
|
http://web.engr.oregonstate.edu/~huanlian/slides/COLING-tutorial-anim.pdf
|
||||||
|
|
||||||
|
Please answer non-coding questions in report.txt.
|
||||||
|
|
||||||
|
0. For the following graphs, decide whether they are
|
||||||
|
(1) directed or undirected, (2) dense or sparse, and (3) cyclic or acyclic:
|
||||||
|
|
||||||
|
(a) Facebook
|
||||||
|
(b) Twitter
|
||||||
|
(c) a family
|
||||||
|
(d) V=airports, E=direct_flights
|
||||||
|
(e) a mesh
|
||||||
|
(f) V=courses, E=prerequisites
|
||||||
|
(g) a tree
|
||||||
|
(h) V=linux_software_packages, E=dependencies
|
||||||
|
(i) DP subproblems for 0-1 knapsack
|
||||||
|
|
||||||
|
Can you name a very big dense graph?
|
||||||
|
|
||||||
|
1. Topological Sort
|
||||||
|
|
||||||
|
For a given directed graph, output a topological order if it exists.
|
||||||
|
|
||||||
|
Tie-breaking: ARBITRARY tie-breaking. This will make the code
|
||||||
|
and time complexity analysis a lot easier.
|
||||||
|
|
||||||
|
e.g., for the following example:
|
||||||
|
|
||||||
|
0 --> 2 --> 3 --> 5 --> 6
|
||||||
|
/ \ | / \
|
||||||
|
/ \ v / \
|
||||||
|
1 > 4 > 7
|
||||||
|
|
||||||
|
>>> order(8, [(0,2), (1,2), (2,3), (2,4), (3,4), (3,5), (4,5), (5,6), (5,7)])
|
||||||
|
[0, 1, 2, 3, 4, 5, 6, 7]
|
||||||
|
|
||||||
|
Note that order() takes two arguments, n and list_of_edges,
|
||||||
|
where n specifies that the nodes are named 0..(n-1).
|
||||||
|
|
||||||
|
If we flip the (3,4) edge:
|
||||||
|
|
||||||
|
>>> order(8, [(0,2), (1,2), (2,3), (2,4), (4,3), (3,5), (4,5), (5,6), (5,7)])
|
||||||
|
[0, 1, 2, 4, 3, 5, 6, 7]
|
||||||
|
|
||||||
|
If there is a cycle, return None
|
||||||
|
|
||||||
|
>>> order(4, [(0,1), (1,2), (2,1), (2,3)])
|
||||||
|
None
|
||||||
|
|
||||||
|
Other cases:
|
||||||
|
|
||||||
|
>>> order(5, [(0,1), (1,2), (2,3), (3,4)])
|
||||||
|
[0, 1, 2, 3, 4]
|
||||||
|
|
||||||
|
>>> order(5, [])
|
||||||
|
[0, 1, 2, 3, 4] # could be any order
|
||||||
|
|
||||||
|
>>> order(3, [(1,2), (2,1)])
|
||||||
|
None
|
||||||
|
|
||||||
|
>>> order(1, [(0,0)]) # self-loop
|
||||||
|
None
|
||||||
|
|
||||||
|
Tie-breaking: arbitrary (any valid topological order is fine).
|
||||||
|
|
||||||
|
filename: topol.py
|
||||||
|
|
||||||
|
questions:
|
||||||
|
(a) did you realize that bottom-up implementations of DP use (implicit) topological orderings?
|
||||||
|
e.g., what is the topological ordering in your (or my) bottom-up bounded knapsack code?
|
||||||
|
(b) what about top-down implementations? what order do they use to traverse the graph?
|
||||||
|
(c) does that suggest there is a top-down solution for topological sort as well?
|
||||||
|
|
||||||
|
2. [WILL BE GRADED]
|
||||||
|
Viterbi Algorithm For Longest Path in DAG (see DPV 4.7, [2], CLRS problem 15-1)
|
||||||
|
|
||||||
|
Recall that the Viterbi algorithm has just two steps:
|
||||||
|
a) get a topological order (use problem 1 above)
|
||||||
|
b) follow that order, and do either forward or backward updates
|
||||||
|
|
||||||
|
This algorithm captures all DP problems on DAGs, for example,
|
||||||
|
longest path, shortest path, number of paths, etc.
|
||||||
|
|
||||||
|
In this problem, given a DAG (guaranteed acyclic!), output a pair (l, p)
|
||||||
|
where l is the length of the longest path (number of edges), and p is the path. (you can think of each edge being unit cost)
|
||||||
|
|
||||||
|
e.g., for the above example:
|
||||||
|
|
||||||
|
>>> longest(8, [(0,2), (1,2), (2,3), (2,4), (3,4), (3,5), (4,5), (5,6), (5,7)])
|
||||||
|
(5, [0, 2, 3, 4, 5, 6])
|
||||||
|
|
||||||
|
>>> longest(8, [(0,2), (1,2), (2,3), (2,4), (4,3), (3,5), (4,5), (5,6), (5,7)])
|
||||||
|
(5, [0, 2, 4, 3, 5, 6])
|
||||||
|
|
||||||
|
>>> longest(8, [(0,1), (0,2), (1,2), (2,3), (2,4), (4,3), (3,5), (4,5), (5,6), (5,7), (6,7)])
|
||||||
|
(7, [0, 1, 2, 4, 3, 5, 6, 7]) # unique answer
|
||||||
|
|
||||||
|
Note that longest() takes two arguments, n and list_of_edges,
|
||||||
|
where n specifies that the nodes are named 0..(n-1).
|
||||||
|
|
||||||
|
Tie-breaking: arbitrary. any longest path is fine.
|
||||||
|
|
||||||
|
Filename: viterbi.py
|
||||||
|
|
||||||
|
Note: you can use this program to solve MIS, knapsacks, coins, etc.
|
||||||
|
|
||||||
|
|
||||||
|
Debriefing (required!): --------------------------
|
||||||
|
|
||||||
|
0. What's your name?
|
||||||
|
1. Approximately how many hours did you spend on this assignment?
|
||||||
|
2. Would you rate it as easy, moderate, or difficult?
|
||||||
|
3. Did you work on it mostly alone, or mostly with other people?
|
||||||
|
4. How deeply do you feel you understand the material it covers (0%-100%)?
|
||||||
|
5. Any other comments?
|
||||||
|
|
||||||
|
This section is intended to help us calibrate the homework assignments.
|
||||||
|
Your answers to this section will *not* affect your grade; however, skipping it
|
||||||
|
will certainly do.
|
||||||
166
code/cs325-langs/hws/hw9.txt
Normal file
166
code/cs325-langs/hws/hw9.txt
Normal file
@@ -0,0 +1,166 @@
|
|||||||
|
CS 325, Algorithms, Fall 2019
|
||||||
|
HW9 - Graphs (part 2), DP (part 4)
|
||||||
|
|
||||||
|
Due Monday Nov 25, 11:59pm.
|
||||||
|
No late submission will be accepted.
|
||||||
|
|
||||||
|
Include in your submission: report.txt, dijkstra.py, nbest.py.
|
||||||
|
dijkstra.py will be graded for correctness (1%).
|
||||||
|
|
||||||
|
Textbooks for References:
|
||||||
|
[1] CLRS Ch. 22 (graph)
|
||||||
|
[2] my DP tutorial (up to page 16):
|
||||||
|
http://web.engr.oregonstate.edu/~huanlian/slides/COLING-tutorial-anim.pdf
|
||||||
|
[3] DPV Ch. 3, 4.2, 4.4, 4.7, 6 (Dasgupta, Papadimitriou, Vazirani)
|
||||||
|
https://www.cs.berkeley.edu/~vazirani/algorithms/chap3.pdf
|
||||||
|
https://www.cs.berkeley.edu/~vazirani/algorithms/chap4.pdf
|
||||||
|
https://www.cs.berkeley.edu/~vazirani/algorithms/chap6.pdf
|
||||||
|
[4] KT Ch. 6 (DP)
|
||||||
|
http://www.aw-bc.com/info/kleinberg/assets/downloads/ch6.pdf
|
||||||
|
[5] KT slides: Greedy II (Dijkstra)
|
||||||
|
http://www.cs.princeton.edu/~wayne/kleinberg-tardos/
|
||||||
|
|
||||||
|
***Please answer time/space complexities for each problem in report.txt.
|
||||||
|
|
||||||
|
1. [WILL BE GRADED]
|
||||||
|
Dijkstra (see CLRS 24.3 and DPV 4.4)
|
||||||
|
|
||||||
|
Given an undirected graph, find the shortest path from source (node 0)
|
||||||
|
to target (node n-1).
|
||||||
|
|
||||||
|
Edge weights are guaranteed to be non-negative, since Dijkstra doesn't work
|
||||||
|
with negative weights, e.g.
|
||||||
|
|
||||||
|
3
|
||||||
|
0 ------ 1
|
||||||
|
\ /
|
||||||
|
2 \ / -2
|
||||||
|
\/
|
||||||
|
2
|
||||||
|
|
||||||
|
in this example, Dijkstra would return length 2 (path 0-2),
|
||||||
|
but path 0-1-2 is better (length 1).
|
||||||
|
|
||||||
|
For example (return a pair of shortest-distance and shortest-path):
|
||||||
|
|
||||||
|
1
|
||||||
|
0 ------ 1
|
||||||
|
\ / \
|
||||||
|
5 \ /1 \6
|
||||||
|
\/ 2 \
|
||||||
|
2 ------ 3
|
||||||
|
|
||||||
|
>>> shortest(4, [(0,1,1), (0,2,5), (1,2,1), (2,3,2), (1,3,6)])
|
||||||
|
(4, [0,1,2,3])
|
||||||
|
|
||||||
|
If the target node (n-1) is unreachable from the source (0),
|
||||||
|
return None:
|
||||||
|
|
||||||
|
>>> shortest(5, [(0,1,1), (0,2,5), (1,2,1), (2,3,2), (1,3,6)])
|
||||||
|
None
|
||||||
|
|
||||||
|
Another example:
|
||||||
|
|
||||||
|
1 1
|
||||||
|
0-----1 2-----3
|
||||||
|
|
||||||
|
>>> shortest(4, [(0,1,1), (2,3,1)])
|
||||||
|
None
|
||||||
|
|
||||||
|
Tiebreaking: arbitrary. Any shortest path would do.
|
||||||
|
|
||||||
|
Filename: dijkstra.py
|
||||||
|
|
||||||
|
Hint: please use heapdict from here:
|
||||||
|
https://raw.githubusercontent.com/DanielStutzbach/heapdict/master/heapdict.py
|
||||||
|
|
||||||
|
>>> from heapdict import heapdict
|
||||||
|
>>> h = heapdict()
|
||||||
|
>>> h['a'] = 3
|
||||||
|
>>> h['b'] = 1
|
||||||
|
>>> h.peekitem()
|
||||||
|
('b', 1)
|
||||||
|
>>> h['a'] = 0
|
||||||
|
>>> h.peekitem()
|
||||||
|
('a', 0)
|
||||||
|
>>> h.popitem()
|
||||||
|
('a', 0)
|
||||||
|
>>> len(h)
|
||||||
|
1
|
||||||
|
>>> 'a' in h
|
||||||
|
False
|
||||||
|
>>> 'b' in h
|
||||||
|
True
|
||||||
|
|
||||||
|
You don't need to submit heapdict.py; we have it in our grader.
|
||||||
|
|
||||||
|
|
||||||
|
2. [Redo the nbest question from Midterm, preparing for HW10 part 3]
|
||||||
|
|
||||||
|
Given k pairs of lists A_i and B_i (0 <= i < k), each with n sorted numbers,
|
||||||
|
find the n smallest pairs in all the (k n^2) pairs.
|
||||||
|
We say (x,y) < (x', y') if and only if x+y < x'+y'.
|
||||||
|
Tie-breaking: lexicographical (i.e., prefer smaller x).
|
||||||
|
|
||||||
|
You can base your code on the skeleton from the Midterm:
|
||||||
|
|
||||||
|
from heapq import heappush, heappop
|
||||||
|
def nbest(ABs): # no need to pass in k or n
|
||||||
|
k = len(ABs)
|
||||||
|
n = len(ABs[0][0])
|
||||||
|
def trypush(i, p, q): # push pair (A_i,p, B_i,q) if possible
|
||||||
|
A, B = ABs[i] # A_i, B_i
|
||||||
|
if p < n and q < n and ______________________________:
|
||||||
|
heappush(h, (________________, i, p, q, (A[p],B[q])))
|
||||||
|
used.add((i, p, q))
|
||||||
|
h, used = ___________________ # initialize
|
||||||
|
for i in range(k): # NEED TO OPTIMIZE
|
||||||
|
trypush(______________)
|
||||||
|
for _ in range(n):
|
||||||
|
_, i, p, q, pair = ________________
|
||||||
|
yield pair # return the next pair (in a lazy list)
|
||||||
|
_______________________
|
||||||
|
_______________________
|
||||||
|
|
||||||
|
|
||||||
|
But recall we had two optimizations to speed up the first for-loop (queue initialization):
|
||||||
|
|
||||||
|
(1) using heapify instead of k initial pushes. You need to implement this (very easy).
|
||||||
|
|
||||||
|
(2) using qselect to choose top n out of the k bests. This one is OPTIONAL.
|
||||||
|
|
||||||
|
Analyze the time complexity for the version you implemented.
|
||||||
|
|
||||||
|
>>> list(nbest([([1,2,4], [2,3,5]), ([0,2,4], [3,4,5])]))
|
||||||
|
|
||||||
|
[(0, 3), (1, 2), (0, 4)]
|
||||||
|
|
||||||
|
>>> list(nbest([([-1,2],[1,4]), ([0,2],[3,4]), ([0,1],[4,6]), ([-1,2],[1,5])]))
|
||||||
|
[(-1, 1), (-1, 1)]
|
||||||
|
|
||||||
|
>>> list(nbest([([5,6,10,14],[3,5,10,14]),([2,7,9,11],[3,8,12,16]),([1,3,8,10],[5,9,10,11]),([1,2,3,5],[3,4,9,10]),([4,5,9,10],[2,4,6,11]),([4,6,10,13],[2,3,5,9]),([3,7,10,12],[1,2,5,10]),([5,9,14,15],[4,8,13,14])]))
|
||||||
|
|
||||||
|
[(1, 3), (3, 1), (1, 4), (2, 3)]
|
||||||
|
|
||||||
|
>>> list(nbest([([1,6,8,13],[5,8,11,12]),([1,2,3,5],[5,9,11,13]),([3,5,7,10],[4,6,7,11]),([1,4,7,8],[4,9,11,15]),([4,8,10,13],[4,6,10,11]),([4,8,12,15],[5,10,11,13]),([2,3,4,8],[4,7,11,15]),([4,5,10,15],[5,6,7,8])]))
|
||||||
|
|
||||||
|
[(1, 4), (1, 5), (1, 5), (2, 4)]
|
||||||
|
|
||||||
|
This problem prepares you for the hardest question in HW10 (part 3).
|
||||||
|
|
||||||
|
Filename: nbest.py
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Debriefing (required!): --------------------------
|
||||||
|
|
||||||
|
0. What's your name?
|
||||||
|
1. Approximately how many hours did you spend on this assignment?
|
||||||
|
2. Would you rate it as easy, moderate, or difficult?
|
||||||
|
3. Did you work on it mostly alone, or mostly with other people?
|
||||||
|
4. How deeply do you feel you understand the material it covers (0%-100%)?
|
||||||
|
5. Any other comments?
|
||||||
|
|
||||||
|
This section is intended to help us calibrate the homework assignments.
|
||||||
|
Your answers to this section will *not* affect your grade; however, skipping it
|
||||||
|
will certainly do.
|
||||||
19
code/cs325-langs/sols/hw1.lang
Normal file
19
code/cs325-langs/sols/hw1.lang
Normal file
@@ -0,0 +1,19 @@
|
|||||||
|
qselect(xs,k) =
|
||||||
|
~xs -> {
|
||||||
|
pivot <- xs[0]!
|
||||||
|
left <- xs[#0 <= pivot]
|
||||||
|
right <- xs[#0 > pivot]
|
||||||
|
} ->
|
||||||
|
if k > |left| + 1 then qselect(right, k - |left| - 1)
|
||||||
|
else if k == |left| + 1 then [pivot]
|
||||||
|
else qselect(left, k);
|
||||||
|
|
||||||
|
_search(xs, k) =
|
||||||
|
if xs[1] == k then xs
|
||||||
|
else if xs[1] > k then _search(xs[0], k)
|
||||||
|
else _search(xs[2], k);
|
||||||
|
|
||||||
|
sorted(xs) = sorted(xs[0]) ++ [xs[1]] ++ sorted(xs[2]);
|
||||||
|
search(xs, k) = |_search(xs, k)| != 0;
|
||||||
|
insert(xs, k) = _insert(k, _search(xs, k));
|
||||||
|
_insert(k, xs) = if |xs| == 0 then xs << [] << k << [] else xs
|
||||||
11
code/cs325-langs/sols/hw2.lang
Normal file
11
code/cs325-langs/sols/hw2.lang
Normal file
@@ -0,0 +1,11 @@
|
|||||||
|
state 0;
|
||||||
|
|
||||||
|
effect {
|
||||||
|
if(SOURCE == R) {
|
||||||
|
STATE = STATE + |LEFT|;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
combine {
|
||||||
|
STATE = STATE + LSTATE + RSTATE;
|
||||||
|
}
|
||||||
95
code/cs325-langs/sols/hw3.lang
Normal file
95
code/cs325-langs/sols/hw3.lang
Normal file
@@ -0,0 +1,95 @@
|
|||||||
|
function qselect(xs, k, c) {
|
||||||
|
if xs == [] {
|
||||||
|
return 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
traverser bisector(list: xs, span: (0,len(xs)));
|
||||||
|
traverser pivot(list: xs, random: true);
|
||||||
|
|
||||||
|
let pivotE = pop!(pivot);
|
||||||
|
let (leftList, rightList) = bisect!(bisector, (x) -> c(x) < c(pivotE));
|
||||||
|
|
||||||
|
if k > len(leftList) + 1 {
|
||||||
|
return qselect(rightList, k - len(leftList) - 1, c);
|
||||||
|
} elsif k == len(leftList) + 1 {
|
||||||
|
return pivotE;
|
||||||
|
} else {
|
||||||
|
return qselect(leftList, k, c);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
function closestUnsorted(xs, k, n) {
|
||||||
|
let min = qselect(list(xs), k, (x) -> abs(x - n));
|
||||||
|
let out = [];
|
||||||
|
let countEqual = k;
|
||||||
|
|
||||||
|
traverser iter(list: xs, span: (0, len(xs)));
|
||||||
|
while valid!(iter) {
|
||||||
|
if abs(at!(iter)-n) < abs(min-n) {
|
||||||
|
let countEqual = countEqual - 1;
|
||||||
|
}
|
||||||
|
step!(iter);
|
||||||
|
}
|
||||||
|
|
||||||
|
traverser iter(list: xs, span: (0, len(xs)));
|
||||||
|
while valid!(iter) {
|
||||||
|
if abs(at!(iter)-n) == abs(min-n) and countEqual > 0 {
|
||||||
|
let countEqual = countEqual - 1;
|
||||||
|
let out = out + [at!(iter)];
|
||||||
|
} elsif abs(at!(iter)-n) < abs(min-n) {
|
||||||
|
let out = out + [at!(iter)];
|
||||||
|
}
|
||||||
|
step!(iter);
|
||||||
|
}
|
||||||
|
|
||||||
|
return out;
|
||||||
|
}
|
||||||
|
|
||||||
|
function closestSorted(xs, k, n) {
|
||||||
|
let start = bisect(xs, n);
|
||||||
|
let counter = 0;
|
||||||
|
traverser left(list: xs, span: (0, start), reverse: true);
|
||||||
|
traverser right(list: xs, span: (start, len(xs)));
|
||||||
|
|
||||||
|
while counter != k and canstep!(left) and valid!(right) {
|
||||||
|
if abs(at!(left, 1) - n) < abs(at!(right) - n) {
|
||||||
|
step!(left);
|
||||||
|
} else {
|
||||||
|
step!(right);
|
||||||
|
}
|
||||||
|
let counter = counter + 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
while counter != k and (canstep!(left) or valid!(right)) {
|
||||||
|
if canstep!(left) { step!(left); }
|
||||||
|
else { step!(right); }
|
||||||
|
let counter = counter + 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
return subset!(left, right);
|
||||||
|
}
|
||||||
|
|
||||||
|
sorted function xyz(xs, k) {
|
||||||
|
traverser x(list: xs, span: (0,len(xs)));
|
||||||
|
let dest = [];
|
||||||
|
|
||||||
|
while valid!(x) {
|
||||||
|
traverser z(list: xs, span: (pos!(x)+2,len(xs)));
|
||||||
|
traverser y(list: xs, span: (pos!(x)+1,pos!(z)));
|
||||||
|
|
||||||
|
while valid!(y) and valid!(z) {
|
||||||
|
if at!(x) + at!(y) == at!(z) {
|
||||||
|
let dest = dest + [(at!(x), at!(y), at!(z))];
|
||||||
|
step!(z);
|
||||||
|
} elsif at!(x) + at!(y) > at!(z) {
|
||||||
|
step!(z);
|
||||||
|
} else {
|
||||||
|
step!(y);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
step!(x);
|
||||||
|
}
|
||||||
|
|
||||||
|
return dest;
|
||||||
|
}
|
||||||
15
code/cs325-langs/src/Common.hs
Normal file
15
code/cs325-langs/src/Common.hs
Normal file
@@ -0,0 +1,15 @@
|
|||||||
|
module Common where
|
||||||
|
import PythonAst
|
||||||
|
import PythonGen
|
||||||
|
import Text.Parsec
|
||||||
|
|
||||||
|
compile :: (String -> String -> Either ParseError p) -> (p -> [PyStmt]) -> String -> IO ()
|
||||||
|
compile p t f = do
|
||||||
|
let inputName = f ++ ".lang"
|
||||||
|
let outputName = f ++ ".py"
|
||||||
|
file <- readFile inputName
|
||||||
|
let either = p inputName file
|
||||||
|
case either of
|
||||||
|
Right prog -> writeFile outputName (translate $ t prog)
|
||||||
|
Left e -> print e
|
||||||
|
|
||||||
90
code/cs325-langs/src/CommonParsing.hs
Normal file
90
code/cs325-langs/src/CommonParsing.hs
Normal file
@@ -0,0 +1,90 @@
|
|||||||
|
module CommonParsing where
|
||||||
|
import Data.Char
|
||||||
|
import Data.Functor
|
||||||
|
import Text.Parsec
|
||||||
|
import Text.Parsec.Char
|
||||||
|
import Text.Parsec.Combinator
|
||||||
|
|
||||||
|
type Parser a b = Parsec String a b
|
||||||
|
|
||||||
|
kw :: String -> Parser a ()
|
||||||
|
kw s = try $ string s <* spaces $> ()
|
||||||
|
|
||||||
|
kwIf :: Parser a ()
|
||||||
|
kwIf = kw "if"
|
||||||
|
|
||||||
|
kwThen :: Parser a ()
|
||||||
|
kwThen = kw "then"
|
||||||
|
|
||||||
|
kwElse :: Parser a ()
|
||||||
|
kwElse = kw "else"
|
||||||
|
|
||||||
|
kwElsif :: Parser a ()
|
||||||
|
kwElsif = kw "elsif"
|
||||||
|
|
||||||
|
kwWhile :: Parser a ()
|
||||||
|
kwWhile = kw "while"
|
||||||
|
|
||||||
|
kwState :: Parser a ()
|
||||||
|
kwState = kw "state"
|
||||||
|
|
||||||
|
kwEffect :: Parser a ()
|
||||||
|
kwEffect = kw "effect"
|
||||||
|
|
||||||
|
kwCombine :: Parser a ()
|
||||||
|
kwCombine = kw "combine"
|
||||||
|
|
||||||
|
kwRand :: Parser a ()
|
||||||
|
kwRand = kw "rand"
|
||||||
|
|
||||||
|
kwFunction :: Parser a ()
|
||||||
|
kwFunction = kw "function"
|
||||||
|
|
||||||
|
kwSorted :: Parser a ()
|
||||||
|
kwSorted = kw "sorted"
|
||||||
|
|
||||||
|
kwLet :: Parser a ()
|
||||||
|
kwLet = kw "let"
|
||||||
|
|
||||||
|
kwTraverser :: Parser a ()
|
||||||
|
kwTraverser = kw "traverser"
|
||||||
|
|
||||||
|
kwReturn :: Parser a ()
|
||||||
|
kwReturn = kw "return"
|
||||||
|
|
||||||
|
op :: String -> op -> Parser a op
|
||||||
|
op s o = string s $> o
|
||||||
|
|
||||||
|
int :: Parser a Int
|
||||||
|
int = read <$> (many1 digit <* spaces)
|
||||||
|
|
||||||
|
var :: [String] -> Parser a String
|
||||||
|
var reserved =
|
||||||
|
do
|
||||||
|
c <- satisfy $ \c -> isLetter c || c == '_'
|
||||||
|
cs <- many (satisfy isLetter <|> digit) <* spaces
|
||||||
|
let name = c:cs
|
||||||
|
if name `elem` reserved
|
||||||
|
then fail "Can't use reserved keyword as identifier"
|
||||||
|
else return name
|
||||||
|
|
||||||
|
list :: Char -> Char -> Char -> Parser a b -> Parser a [b]
|
||||||
|
list co cc cd pe = surround co cc $ sepBy pe (char cd >> spaces)
|
||||||
|
|
||||||
|
surround :: Char -> Char -> Parser a b -> Parser a b
|
||||||
|
surround c1 c2 pe =
|
||||||
|
do
|
||||||
|
char c1 >> spaces
|
||||||
|
e <- pe
|
||||||
|
spaces >> char c2 >> spaces
|
||||||
|
return e
|
||||||
|
|
||||||
|
level :: (o -> e -> e -> e) -> Parser a o -> Parser a e -> Parser a e
|
||||||
|
level c po pe =
|
||||||
|
do
|
||||||
|
e <- pe <* spaces
|
||||||
|
ops <- many $ try $ (flip . c <$> (po <* spaces) <*> pe) <* spaces
|
||||||
|
return $ foldl (flip ($)) e ops
|
||||||
|
|
||||||
|
precedence :: (o -> e -> e -> e) -> Parser a e -> [ Parser a o ] -> Parser a e
|
||||||
|
precedence = foldl . flip . level
|
||||||
393
code/cs325-langs/src/LanguageOne.hs
Normal file
393
code/cs325-langs/src/LanguageOne.hs
Normal file
@@ -0,0 +1,393 @@
|
|||||||
|
module LanguageOne where
|
||||||
|
import qualified PythonAst as Py
|
||||||
|
import qualified CommonParsing as P
|
||||||
|
import Data.Bifunctor
|
||||||
|
import Data.Char
|
||||||
|
import Data.Functor
|
||||||
|
import qualified Data.Map as Map
|
||||||
|
import Data.Maybe
|
||||||
|
import qualified Data.Set as Set
|
||||||
|
import Text.Parsec
|
||||||
|
import Text.Parsec.Char
|
||||||
|
import Text.Parsec.Combinator
|
||||||
|
import Control.Monad.State
|
||||||
|
|
||||||
|
{- Data Types -}
|
||||||
|
data PossibleType = List | Any deriving Eq
|
||||||
|
|
||||||
|
data SelectorMarker = None | Remove
|
||||||
|
|
||||||
|
data Op
|
||||||
|
= Add
|
||||||
|
| Subtract
|
||||||
|
| Multiply
|
||||||
|
| Divide
|
||||||
|
| Insert
|
||||||
|
| Concat
|
||||||
|
| LessThan
|
||||||
|
| LessThanEq
|
||||||
|
| GreaterThan
|
||||||
|
| GreaterThanEq
|
||||||
|
| Equal
|
||||||
|
| NotEqual
|
||||||
|
| And
|
||||||
|
| Or
|
||||||
|
|
||||||
|
data Selector = Selector String Expr
|
||||||
|
|
||||||
|
data Expr
|
||||||
|
= Var String
|
||||||
|
| IntLiteral Int
|
||||||
|
| ListLiteral [Expr]
|
||||||
|
| Split Expr [Selector] Expr
|
||||||
|
| IfElse Expr Expr Expr
|
||||||
|
| BinOp Op Expr Expr
|
||||||
|
| FunctionCall Expr [Expr]
|
||||||
|
| LengthOf Expr
|
||||||
|
| Random
|
||||||
|
| Access Expr Expr SelectorMarker
|
||||||
|
| Parameter Int
|
||||||
|
|
||||||
|
data Function = Function String [String] Expr
|
||||||
|
|
||||||
|
data Prog = Prog [Function]
|
||||||
|
|
||||||
|
{- Parser -}
|
||||||
|
type Parser = Parsec String (Maybe Int)
|
||||||
|
|
||||||
|
parseVar :: Parser String
|
||||||
|
parseVar = P.var ["if", "then", "else", "var"]
|
||||||
|
|
||||||
|
parseThis :: Parser Expr
|
||||||
|
parseThis =
|
||||||
|
do
|
||||||
|
char '&'
|
||||||
|
contextNum <- getState
|
||||||
|
spaces
|
||||||
|
return (Var $ "context_" ++ show contextNum)
|
||||||
|
|
||||||
|
parseList :: Parser Expr
|
||||||
|
parseList = ListLiteral <$>
|
||||||
|
do
|
||||||
|
char '[' >> spaces
|
||||||
|
es <- sepBy parseExpr (char ',' >> spaces)
|
||||||
|
spaces >> char ']' >> spaces
|
||||||
|
return es
|
||||||
|
|
||||||
|
parseSplit :: Parser Expr
|
||||||
|
parseSplit =
|
||||||
|
do
|
||||||
|
char '~' >> spaces
|
||||||
|
e <- parseExpr
|
||||||
|
spaces >> string "->"
|
||||||
|
spaces >> char '{'
|
||||||
|
contextNum <- getState
|
||||||
|
putState $ return $ 1 + fromMaybe (-1) contextNum
|
||||||
|
es <- many1 (spaces >> parseSelector)
|
||||||
|
putState contextNum
|
||||||
|
spaces >> char '}' >> spaces >> string "->" >> spaces
|
||||||
|
e' <- parseExpr
|
||||||
|
spaces
|
||||||
|
return $ Split e es e'
|
||||||
|
|
||||||
|
parseSelectorMarker :: Parser SelectorMarker
|
||||||
|
parseSelectorMarker = (char '!' >> return Remove) <|> return None
|
||||||
|
|
||||||
|
parseSelector :: Parser Selector
|
||||||
|
parseSelector =
|
||||||
|
do
|
||||||
|
name <- parseVar
|
||||||
|
spaces >> string "<-" >> spaces
|
||||||
|
expr <- parseExpr
|
||||||
|
spaces
|
||||||
|
return $ Selector name expr
|
||||||
|
|
||||||
|
parseIfElse :: Parser Expr
|
||||||
|
parseIfElse =
|
||||||
|
do
|
||||||
|
P.kwIf >> spaces
|
||||||
|
ec <- parseExpr
|
||||||
|
spaces >> P.kwThen >> spaces
|
||||||
|
et <- parseExpr
|
||||||
|
spaces >> P.kwElse >> spaces
|
||||||
|
ee <- parseExpr
|
||||||
|
spaces
|
||||||
|
return $ IfElse ec et ee
|
||||||
|
|
||||||
|
parseLength :: Parser Expr
|
||||||
|
parseLength =
|
||||||
|
do
|
||||||
|
char '|' >> spaces
|
||||||
|
e <- parseExpr
|
||||||
|
spaces >> char '|' >> spaces
|
||||||
|
return $ LengthOf e
|
||||||
|
|
||||||
|
parseParameter :: Parser Expr
|
||||||
|
parseParameter =
|
||||||
|
do
|
||||||
|
char '#'
|
||||||
|
d <- digit
|
||||||
|
spaces
|
||||||
|
return $ Parameter $ read [d]
|
||||||
|
|
||||||
|
parseParenthesized :: Parser Expr
|
||||||
|
parseParenthesized =
|
||||||
|
do
|
||||||
|
char '(' >> spaces
|
||||||
|
e <- parseExpr
|
||||||
|
spaces >> char ')' >> spaces
|
||||||
|
return e
|
||||||
|
|
||||||
|
parseBasicExpr :: Parser Expr
|
||||||
|
parseBasicExpr = choice
|
||||||
|
[ IntLiteral <$> P.int
|
||||||
|
, parseThis
|
||||||
|
, parseList
|
||||||
|
, parseSplit
|
||||||
|
, parseLength
|
||||||
|
, parseParameter
|
||||||
|
, parseParenthesized
|
||||||
|
, Var <$> try parseVar
|
||||||
|
, P.kwRand $> Random
|
||||||
|
, parseIfElse
|
||||||
|
]
|
||||||
|
|
||||||
|
parsePostfix :: Parser (Expr -> Expr)
|
||||||
|
parsePostfix = parsePostfixAccess <|> parsePostfixCall
|
||||||
|
|
||||||
|
parsePostfixAccess :: Parser (Expr -> Expr)
|
||||||
|
parsePostfixAccess =
|
||||||
|
do
|
||||||
|
char '[' >> spaces
|
||||||
|
e <- parseExpr
|
||||||
|
spaces >> char ']' >> spaces
|
||||||
|
marker <- parseSelectorMarker
|
||||||
|
spaces
|
||||||
|
return $ \e' -> Access e' e marker
|
||||||
|
|
||||||
|
parsePostfixCall :: Parser (Expr -> Expr)
|
||||||
|
parsePostfixCall =
|
||||||
|
do
|
||||||
|
char '(' >> spaces
|
||||||
|
es <- sepBy parseExpr (char ',' >> spaces)
|
||||||
|
char ')' >> spaces
|
||||||
|
return $ flip FunctionCall es
|
||||||
|
|
||||||
|
parsePostfixedExpr :: Parser Expr
|
||||||
|
parsePostfixedExpr =
|
||||||
|
do
|
||||||
|
eb <- parseBasicExpr
|
||||||
|
spaces
|
||||||
|
ps <- many parsePostfix
|
||||||
|
return $ foldl (flip ($)) eb ps
|
||||||
|
|
||||||
|
parseExpr :: Parser Expr
|
||||||
|
parseExpr = P.precedence BinOp parsePostfixedExpr
|
||||||
|
[ P.op "*" Multiply, P.op "/" Divide
|
||||||
|
, P.op "+" Add, P.op "-" Subtract
|
||||||
|
, P.op "<<" Insert
|
||||||
|
, P.op "++" Concat
|
||||||
|
, try (P.op "<=" LessThanEq) <|> try (P.op ">=" GreaterThanEq) <|>
|
||||||
|
P.op "<" LessThan <|> P.op ">" GreaterThan <|>
|
||||||
|
P.op "==" Equal <|> P.op "!=" NotEqual
|
||||||
|
, P.op "&&" And <|> P.op "||" Or
|
||||||
|
]
|
||||||
|
|
||||||
|
parseFunction :: Parser Function
|
||||||
|
parseFunction =
|
||||||
|
do
|
||||||
|
name <- parseVar
|
||||||
|
spaces >> char '(' >> spaces
|
||||||
|
vs <- sepBy parseVar (char ',' >> spaces)
|
||||||
|
spaces >> char ')' >> spaces >> char '=' >> spaces
|
||||||
|
body <- parseExpr
|
||||||
|
spaces
|
||||||
|
return $ Function name vs body
|
||||||
|
|
||||||
|
parseProg :: Parser Prog
|
||||||
|
parseProg = Prog <$> sepBy1 parseFunction (char ';' >> spaces)
|
||||||
|
|
||||||
|
parse :: SourceName -> String -> Either ParseError Prog
|
||||||
|
parse = runParser parseProg Nothing
|
||||||
|
|
||||||
|
{- "Type" checker -}
|
||||||
|
mergePossibleType :: PossibleType -> PossibleType -> PossibleType
|
||||||
|
mergePossibleType List _ = List
|
||||||
|
mergePossibleType _ List = List
|
||||||
|
mergePossibleType _ _ = Any
|
||||||
|
|
||||||
|
getPossibleType :: String -> Expr -> PossibleType
|
||||||
|
getPossibleType s (Var s') = if s == s' then List else Any
|
||||||
|
getPossibleType _ (ListLiteral _) = List
|
||||||
|
getPossibleType s (Split _ _ e) = getPossibleType s e
|
||||||
|
getPossibleType s (IfElse i t e) =
|
||||||
|
foldl1 mergePossibleType $ map (getPossibleType s) [i, t, e]
|
||||||
|
getPossibleType _ (BinOp Insert _ _) = List
|
||||||
|
getPossibleType _ (BinOp Concat _ _) = List
|
||||||
|
getPossibleType _ _ = Any
|
||||||
|
|
||||||
|
{- Translator -}
|
||||||
|
type Translator = Control.Monad.State.State (Map.Map String [String], Int)
|
||||||
|
|
||||||
|
currentTemp :: Translator String
|
||||||
|
currentTemp = do
|
||||||
|
t <- gets snd
|
||||||
|
return $ "temp" ++ show t
|
||||||
|
|
||||||
|
incrementTemp :: Translator String
|
||||||
|
incrementTemp = do
|
||||||
|
modify (second (+1))
|
||||||
|
currentTemp
|
||||||
|
|
||||||
|
hasLambda :: Expr -> Bool
|
||||||
|
hasLambda (ListLiteral es) = any hasLambda es
|
||||||
|
hasLambda (Split e ss r) =
|
||||||
|
hasLambda e || any (\(Selector _ e') -> hasLambda e') ss || hasLambda r
|
||||||
|
hasLambda (IfElse i t e) = hasLambda i || hasLambda t || hasLambda e
|
||||||
|
hasLambda (BinOp o l r) = hasLambda l || hasLambda r
|
||||||
|
hasLambda (FunctionCall e es) = any hasLambda $ e : es
|
||||||
|
hasLambda (LengthOf e) = hasLambda e
|
||||||
|
hasLambda (Access e _ _) = hasLambda e
|
||||||
|
hasLambda Parameter{} = True
|
||||||
|
hasLambda _ = False
|
||||||
|
|
||||||
|
translate :: Prog -> [Py.PyStmt]
|
||||||
|
translate p = fst $ runState (translateProg p) (Map.empty, 0)
|
||||||
|
|
||||||
|
translateProg :: Prog -> Translator [Py.PyStmt]
|
||||||
|
translateProg (Prog fs) = concat <$> traverse translateFunction fs
|
||||||
|
|
||||||
|
translateFunction :: Function -> Translator [Py.PyStmt]
|
||||||
|
translateFunction (Function n ps ex) = do
|
||||||
|
let createIf p = Py.BinOp Py.Equal (Py.Var p) (Py.ListLiteral [])
|
||||||
|
let createReturn p = Py.IfElse (createIf p) [Py.Return (Py.Var p)] [] Nothing
|
||||||
|
let fastReturn = [createReturn p | p <- take 1 ps, getPossibleType p ex == List]
|
||||||
|
(ss, e) <- translateExpr ex
|
||||||
|
return $ return $ Py.FunctionDef n ps $ fastReturn ++ ss ++ [Py.Return e]
|
||||||
|
|
||||||
|
translateSelector :: Selector -> Translator Py.PyStmt
|
||||||
|
translateSelector (Selector n e) =
|
||||||
|
let
|
||||||
|
cacheCheck = Py.NotIn (Py.StrLiteral n) (Py.Var "cache")
|
||||||
|
cacheAccess = Py.Access (Py.Var "cache") [Py.StrLiteral n]
|
||||||
|
cacheSet = Py.Assign (Py.AccessPat (Py.Var "cache") [Py.StrLiteral n])
|
||||||
|
body e' = [ Py.IfElse cacheCheck [cacheSet e'] [] Nothing, Py.Return cacheAccess]
|
||||||
|
in
|
||||||
|
do
|
||||||
|
(ss, e') <- translateExpr e
|
||||||
|
vs <- gets fst
|
||||||
|
let callPrereq p = Py.Standalone $ Py.FunctionCall (Py.Var p) []
|
||||||
|
let prereqs = maybe [] (map callPrereq) $ Map.lookup n vs
|
||||||
|
return $ Py.FunctionDef n [] $ ss ++ prereqs ++ body e'
|
||||||
|
|
||||||
|
translateExpr :: Expr -> Translator ([Py.PyStmt], Py.PyExpr)
|
||||||
|
translateExpr (Var s) = do
|
||||||
|
vs <- gets fst
|
||||||
|
let sVar = Py.Var s
|
||||||
|
let expr = if Map.member s vs then Py.FunctionCall sVar [] else sVar
|
||||||
|
return ([], expr)
|
||||||
|
translateExpr (IntLiteral i) = return ([], Py.IntLiteral i)
|
||||||
|
translateExpr (ListLiteral l) = do
|
||||||
|
tl <- mapM translateExpr l
|
||||||
|
return (concatMap fst tl, Py.ListLiteral $ map snd tl)
|
||||||
|
translateExpr (Split e ss e') = do
|
||||||
|
vs <- gets fst
|
||||||
|
let cacheAssign = Py.Assign (Py.VarPat "cache") (Py.DictLiteral [])
|
||||||
|
let cacheStmt = [ cacheAssign | Map.size vs == 0 ]
|
||||||
|
let vnames = map (\(Selector n es) -> n) ss
|
||||||
|
let prereqs = snd $ foldl (\(ds, m) (Selector n es) -> (n:ds, Map.insert n ds m)) ([], Map.empty) ss
|
||||||
|
modify $ first $ Map.union prereqs
|
||||||
|
fs <- mapM translateSelector ss
|
||||||
|
(sts, te) <- translateExpr e'
|
||||||
|
modify $ first $ const vs
|
||||||
|
return (cacheStmt ++ fs ++ sts, te)
|
||||||
|
translateExpr (IfElse i t e) = do
|
||||||
|
temp <- incrementTemp
|
||||||
|
let tempPat = Py.VarPat temp
|
||||||
|
(ists, ie) <- translateExpr i
|
||||||
|
(tsts, te) <- translateExpr t
|
||||||
|
(ests, ee) <- translateExpr e
|
||||||
|
let thenSts = tsts ++ [Py.Assign tempPat te]
|
||||||
|
let elseSts = ests ++ [Py.Assign tempPat ee]
|
||||||
|
let newIf = Py.IfElse ie thenSts [] $ Just elseSts
|
||||||
|
return (ists ++ [newIf], Py.Var temp)
|
||||||
|
translateExpr (BinOp o l r) = do
|
||||||
|
(lsts, le) <- translateExpr l
|
||||||
|
(rsts, re) <- translateExpr r
|
||||||
|
(opsts, oe) <- translateOp o le re
|
||||||
|
return (lsts ++ rsts ++ opsts, oe)
|
||||||
|
translateExpr (FunctionCall f ps) = do
|
||||||
|
(fsts, fe) <- translateExpr f
|
||||||
|
tps <- mapM translateExpr ps
|
||||||
|
return (fsts ++ concatMap fst tps, Py.FunctionCall fe $ map snd tps)
|
||||||
|
translateExpr (LengthOf e) =
|
||||||
|
second (Py.FunctionCall (Py.Var "len") . return) <$> translateExpr e
|
||||||
|
translateExpr (Access e Random m) = do
|
||||||
|
temp <- incrementTemp
|
||||||
|
(sts, ce) <- translateExpr e
|
||||||
|
let lenExpr = Py.FunctionCall (Py.Var "len") [Py.Var temp]
|
||||||
|
let randExpr = Py.FunctionCall (Py.Var "randint") [ Py.IntLiteral 0, lenExpr ]
|
||||||
|
return (sts, singleAccess ce randExpr m)
|
||||||
|
translateExpr (Access c i m) = do
|
||||||
|
(csts, ce) <- translateExpr c
|
||||||
|
(ists, ie) <- translateExpr i
|
||||||
|
temp <- incrementTemp
|
||||||
|
if hasLambda i
|
||||||
|
then return (csts ++ ists ++ [createFilterLambda temp ie m], Py.FunctionCall (Py.Var temp) [ce])
|
||||||
|
else return (csts ++ ists, singleAccess ce ie m)
|
||||||
|
translateExpr (Parameter i) = return $ ([], Py.Var $ "arg" ++ show i)
|
||||||
|
translateExpr _ = fail "Invalid expression"
|
||||||
|
|
||||||
|
singleAccess :: Py.PyExpr -> Py.PyExpr -> SelectorMarker -> Py.PyExpr
|
||||||
|
singleAccess c i None = Py.Access c [i]
|
||||||
|
singleAccess c i Remove = Py.FunctionCall (Py.Member c "pop") [i]
|
||||||
|
|
||||||
|
createFilterLambda :: String -> Py.PyExpr -> SelectorMarker -> Py.PyStmt
|
||||||
|
createFilterLambda s e None = Py.FunctionDef s ["arg"]
|
||||||
|
[ Py.Assign (Py.VarPat "out") (Py.ListLiteral [])
|
||||||
|
, Py.For (Py.VarPat "arg0") (Py.Var "arg")
|
||||||
|
[ Py.IfElse e
|
||||||
|
[ Py.Standalone $ Py.FunctionCall (Py.Member (Py.Var "out") "append")
|
||||||
|
[ Py.Var "arg0" ]
|
||||||
|
]
|
||||||
|
[]
|
||||||
|
Nothing
|
||||||
|
]
|
||||||
|
, Py.Return $ Py.Var "out"
|
||||||
|
]
|
||||||
|
createFilterLambda s e Remove = Py.FunctionDef s ["arg"]
|
||||||
|
[ Py.Assign (Py.VarPat "i") $ Py.IntLiteral 0
|
||||||
|
, Py.Assign (Py.VarPat "out") (Py.ListLiteral [])
|
||||||
|
, Py.While (Py.BinOp Py.LessThan (Py.Var "i") $ Py.FunctionCall (Py.Var "len") [Py.Var "arg"])
|
||||||
|
[ Py.IfElse e
|
||||||
|
[ Py.Standalone $ Py.FunctionCall (Py.Member (Py.Var "out") "append")
|
||||||
|
[ singleAccess (Py.Var "arg") (Py.Var "i") Remove
|
||||||
|
]
|
||||||
|
]
|
||||||
|
[]
|
||||||
|
Nothing
|
||||||
|
, Py.Assign (Py.VarPat "i") (Py.BinOp Py.Add (Py.Var "i") (Py.IntLiteral 1))
|
||||||
|
]
|
||||||
|
, Py.Return $ Py.Var "out"
|
||||||
|
]
|
||||||
|
|
||||||
|
translateOp :: Op -> Py.PyExpr -> Py.PyExpr -> Translator ([Py.PyStmt], Py.PyExpr)
|
||||||
|
translateOp Add l r = return ([], Py.BinOp Py.Add l r)
|
||||||
|
translateOp Subtract l r = return ([], Py.BinOp Py.Subtract l r)
|
||||||
|
translateOp Multiply l r = return ([], Py.BinOp Py.Multiply l r)
|
||||||
|
translateOp Divide l r = return ([], Py.BinOp Py.Divide l r)
|
||||||
|
translateOp LessThan l r = return ([], Py.BinOp Py.LessThan l r)
|
||||||
|
translateOp LessThanEq l r = return ([], Py.BinOp Py.LessThanEq l r)
|
||||||
|
translateOp GreaterThan l r = return ([], Py.BinOp Py.GreaterThan l r)
|
||||||
|
translateOp GreaterThanEq l r = return ([], Py.BinOp Py.GreaterThanEq l r)
|
||||||
|
translateOp Equal l r = return ([], Py.BinOp Py.Equal l r)
|
||||||
|
translateOp NotEqual l r = return ([], Py.BinOp Py.NotEqual l r)
|
||||||
|
translateOp And l r = return ([], Py.BinOp Py.And l r)
|
||||||
|
translateOp Or l r = return ([], Py.BinOp Py.Or l r)
|
||||||
|
translateOp Concat l r = return ([], Py.BinOp Py.Add l r)
|
||||||
|
translateOp Insert l r = do
|
||||||
|
temp <- incrementTemp
|
||||||
|
let assignStmt = Py.Assign (Py.VarPat temp) l
|
||||||
|
let appendFunc = Py.Member (Py.Var temp) "append"
|
||||||
|
let insertStmt = Py.Standalone $ Py.FunctionCall appendFunc [r]
|
||||||
|
return ([assignStmt, insertStmt], Py.Var temp)
|
||||||
461
code/cs325-langs/src/LanguageThree.hs
Normal file
461
code/cs325-langs/src/LanguageThree.hs
Normal file
@@ -0,0 +1,461 @@
|
|||||||
|
module LanguageThree where
|
||||||
|
import qualified CommonParsing as P
|
||||||
|
import qualified PythonAst as Py
|
||||||
|
import Control.Monad.State
|
||||||
|
import Data.Bifunctor
|
||||||
|
import Data.Foldable
|
||||||
|
import Data.Functor
|
||||||
|
import qualified Data.Map as Map
|
||||||
|
import Data.Maybe
|
||||||
|
import Text.Parsec hiding (State)
|
||||||
|
import Text.Parsec.Char
|
||||||
|
import Text.Parsec.Combinator
|
||||||
|
|
||||||
|
{- Data Types -}
|
||||||
|
data Op
|
||||||
|
= Add
|
||||||
|
| Subtract
|
||||||
|
| Multiply
|
||||||
|
| Divide
|
||||||
|
| LessThan
|
||||||
|
| LessThanEqual
|
||||||
|
| GreaterThan
|
||||||
|
| GreaterThanEqual
|
||||||
|
| Equal
|
||||||
|
| NotEqual
|
||||||
|
| And
|
||||||
|
| Or
|
||||||
|
|
||||||
|
data Expr
|
||||||
|
= TraverserCall String [Expr]
|
||||||
|
| FunctionCall String [Expr]
|
||||||
|
| BinOp Op Expr Expr
|
||||||
|
| Lambda [String] Expr
|
||||||
|
| Var String
|
||||||
|
| IntLiteral Int
|
||||||
|
| BoolLiteral Bool
|
||||||
|
| ListLiteral [Expr]
|
||||||
|
| TupleLiteral [Expr]
|
||||||
|
|
||||||
|
type Branch = (Expr, [Stmt])
|
||||||
|
|
||||||
|
data Stmt
|
||||||
|
= IfElse Branch [Branch] [Stmt]
|
||||||
|
| While Branch
|
||||||
|
| Traverser String [(String, Expr)]
|
||||||
|
| Let Pat Expr
|
||||||
|
| Return Expr
|
||||||
|
| Standalone Expr
|
||||||
|
|
||||||
|
data Pat
|
||||||
|
= VarPat String
|
||||||
|
| TuplePat [Pat]
|
||||||
|
|
||||||
|
data SortedMarker = Sorted | Unsorted deriving Eq
|
||||||
|
|
||||||
|
data Function = Function SortedMarker String [String] [Stmt]
|
||||||
|
|
||||||
|
data Prog = Prog [Function]
|
||||||
|
|
||||||
|
{- Parser -}
|
||||||
|
type Parser = Parsec String ()
|
||||||
|
|
||||||
|
parseVar :: Parser String
|
||||||
|
parseVar = P.var
|
||||||
|
[ "if", "elif", "else"
|
||||||
|
, "while", "let", "traverser"
|
||||||
|
, "function", "sort"
|
||||||
|
, "true", "false"
|
||||||
|
]
|
||||||
|
|
||||||
|
parseBool :: Parser Bool
|
||||||
|
parseBool = (string "true" $> True) <|> (string "false" $> False)
|
||||||
|
|
||||||
|
parseList :: Parser Expr
|
||||||
|
parseList = ListLiteral <$> P.list '[' ']' ',' parseExpr
|
||||||
|
|
||||||
|
parseTupleElems :: Parser [Expr]
|
||||||
|
parseTupleElems = P.list '(' ')' ',' parseExpr
|
||||||
|
|
||||||
|
parseTuple :: Parser Expr
|
||||||
|
parseTuple = do
|
||||||
|
es <- parseTupleElems
|
||||||
|
return $ case es of
|
||||||
|
e:[] -> e
|
||||||
|
_ -> TupleLiteral es
|
||||||
|
|
||||||
|
parseLambda :: Parser Expr
|
||||||
|
parseLambda = try $ do
|
||||||
|
vs <- P.list '(' ')' ',' parseVar
|
||||||
|
string "->" >> spaces
|
||||||
|
Lambda vs <$> parseExpr
|
||||||
|
|
||||||
|
parseCall :: Parser Expr
|
||||||
|
parseCall = try $ do
|
||||||
|
v <- parseVar
|
||||||
|
choice
|
||||||
|
[ TraverserCall v <$> (char '!' *> parseTupleElems)
|
||||||
|
, FunctionCall v <$> parseTupleElems
|
||||||
|
]
|
||||||
|
|
||||||
|
parseBasic :: Parser Expr
|
||||||
|
parseBasic = choice
|
||||||
|
[ IntLiteral <$> P.int
|
||||||
|
, BoolLiteral <$> parseBool
|
||||||
|
, try parseCall
|
||||||
|
, Var <$> parseVar
|
||||||
|
, parseList
|
||||||
|
, parseLambda
|
||||||
|
, parseTuple
|
||||||
|
]
|
||||||
|
|
||||||
|
parseExpr :: Parser Expr
|
||||||
|
parseExpr = P.precedence BinOp parseBasic
|
||||||
|
[ P.op "*" Multiply <|> P.op "/" Divide
|
||||||
|
, P.op "+" Add <|> P.op "-" Subtract
|
||||||
|
, P.op "==" Equal <|> P.op "!=" NotEqual <|>
|
||||||
|
try (P.op "<=" LessThanEqual) <|> P.op "<" LessThan <|>
|
||||||
|
try (P.op ">=" GreaterThanEqual) <|> P.op ">" GreaterThan
|
||||||
|
, P.op "and" And
|
||||||
|
, P.op "or" Or
|
||||||
|
]
|
||||||
|
|
||||||
|
parseBlock :: Parser [Stmt]
|
||||||
|
parseBlock = char '{' >> spaces >> many parseStmt <* char '}' <* spaces
|
||||||
|
|
||||||
|
parseBranch :: Parser Branch
|
||||||
|
parseBranch = (,) <$> (parseExpr <* spaces) <*> parseBlock
|
||||||
|
|
||||||
|
parseIf :: Parser Stmt
|
||||||
|
parseIf = do
|
||||||
|
i <- P.kwIf >> parseBranch
|
||||||
|
els <- many (P.kwElsif >> parseBranch)
|
||||||
|
e <- try (P.kwElse >> parseBlock) <|> return []
|
||||||
|
return $ IfElse i els e
|
||||||
|
|
||||||
|
parseWhile :: Parser Stmt
|
||||||
|
parseWhile = While <$> (P.kwWhile >> parseBranch)
|
||||||
|
|
||||||
|
parseTraverser :: Parser Stmt
|
||||||
|
parseTraverser = Traverser
|
||||||
|
<$> (P.kwTraverser *> parseVar)
|
||||||
|
<*> (P.list '(' ')' ',' parseKey) <* char ';' <* spaces
|
||||||
|
|
||||||
|
parseKey :: Parser (String, Expr)
|
||||||
|
parseKey = (,)
|
||||||
|
<$> (parseVar <* spaces <* char ':' <* spaces)
|
||||||
|
<*> parseExpr
|
||||||
|
|
||||||
|
parseLet :: Parser Stmt
|
||||||
|
parseLet = Let
|
||||||
|
<$> (P.kwLet >> parsePat <* char '=' <* spaces)
|
||||||
|
<*> parseExpr <* char ';' <* spaces
|
||||||
|
|
||||||
|
parseReturn :: Parser Stmt
|
||||||
|
parseReturn = Return <$> (P.kwReturn >> parseExpr <* char ';' <* spaces)
|
||||||
|
|
||||||
|
parsePat :: Parser Pat
|
||||||
|
parsePat = (VarPat <$> parseVar) <|> (TuplePat <$> P.list '(' ')' ',' parsePat)
|
||||||
|
|
||||||
|
parseStmt :: Parser Stmt
|
||||||
|
parseStmt = choice
|
||||||
|
[ parseTraverser
|
||||||
|
, parseLet
|
||||||
|
, parseIf
|
||||||
|
, parseWhile
|
||||||
|
, parseReturn
|
||||||
|
, Standalone <$> (parseExpr <* char ';' <* spaces)
|
||||||
|
]
|
||||||
|
|
||||||
|
parseFunction :: Parser Function
|
||||||
|
parseFunction = Function
|
||||||
|
<$> (P.kwSorted $> Sorted <|> return Unsorted)
|
||||||
|
<*> (P.kwFunction >> parseVar)
|
||||||
|
<*> (P.list '(' ')' ',' parseVar)
|
||||||
|
<*> parseBlock
|
||||||
|
|
||||||
|
parseProg :: Parser Prog
|
||||||
|
parseProg = Prog <$> many parseFunction
|
||||||
|
|
||||||
|
parse :: String -> String -> Either ParseError Prog
|
||||||
|
parse = runParser parseProg ()
|
||||||
|
|
||||||
|
{- Translation -}
|
||||||
|
data TraverserBounds = Range Py.PyExpr Py.PyExpr | Random
|
||||||
|
|
||||||
|
data TraverserData = TraverserData
|
||||||
|
{ list :: Maybe String
|
||||||
|
, bounds :: Maybe TraverserBounds
|
||||||
|
, rev :: Bool
|
||||||
|
}
|
||||||
|
|
||||||
|
data ValidTraverserData = ValidTraverserData
|
||||||
|
{ validList :: String
|
||||||
|
, validBounds :: TraverserBounds
|
||||||
|
, validRev :: Bool
|
||||||
|
}
|
||||||
|
|
||||||
|
type Translator = State (Map.Map String ValidTraverserData, [Py.PyStmt], Int)
|
||||||
|
|
||||||
|
getScoped :: Translator (Map.Map String ValidTraverserData)
|
||||||
|
getScoped = gets (\(m, _, _) -> m)
|
||||||
|
|
||||||
|
setScoped :: Map.Map String ValidTraverserData -> Translator ()
|
||||||
|
setScoped m = modify (\(_, ss, i) -> (m, ss, i))
|
||||||
|
|
||||||
|
scope :: Translator a -> Translator a
|
||||||
|
scope m = do
|
||||||
|
s <- getScoped
|
||||||
|
a <- m
|
||||||
|
setScoped s
|
||||||
|
return a
|
||||||
|
|
||||||
|
clearTraverser :: String -> Translator ()
|
||||||
|
clearTraverser s = modify (\(m, ss, i) -> (Map.delete s m, ss, i))
|
||||||
|
|
||||||
|
putTraverser :: String -> ValidTraverserData -> Translator ()
|
||||||
|
putTraverser s vtd = modify (\(m, ss, i) -> (Map.insert s vtd m, ss, i))
|
||||||
|
|
||||||
|
getTemp :: Translator String
|
||||||
|
getTemp = gets $ \(_, _, i) -> "temp" ++ show i
|
||||||
|
|
||||||
|
freshTemp :: Translator String
|
||||||
|
freshTemp = modify (second (+1)) >> getTemp
|
||||||
|
|
||||||
|
emitStatement :: Py.PyStmt -> Translator ()
|
||||||
|
emitStatement = modify . first . (:)
|
||||||
|
|
||||||
|
collectStatements :: Translator a -> Translator ([Py.PyStmt], a)
|
||||||
|
collectStatements t = do
|
||||||
|
modify (first $ const [])
|
||||||
|
a <- t
|
||||||
|
ss <- gets $ \(_, ss, _) -> ss
|
||||||
|
modify (first $ const [])
|
||||||
|
return (ss, a)
|
||||||
|
|
||||||
|
withdrawStatements :: Translator (Py.PyStmt) -> Translator [Py.PyStmt]
|
||||||
|
withdrawStatements ts =
|
||||||
|
(\(ss, s) -> ss ++ [s]) <$> (collectStatements ts)
|
||||||
|
|
||||||
|
requireTraverser :: String -> Translator ValidTraverserData
|
||||||
|
requireTraverser s = gets (\(m, _, _) -> Map.lookup s m) >>= handleMaybe
|
||||||
|
where
|
||||||
|
handleMaybe Nothing = fail "Invalid traverser"
|
||||||
|
handleMaybe (Just vtd) = return vtd
|
||||||
|
|
||||||
|
traverserIncrement :: Bool -> Py.PyExpr -> Py.PyExpr -> Py.PyExpr
|
||||||
|
traverserIncrement rev by e =
|
||||||
|
Py.BinOp op e (Py.BinOp Py.Multiply by (Py.IntLiteral 1))
|
||||||
|
where op = if rev then Py.Subtract else Py.Add
|
||||||
|
|
||||||
|
traverserValid :: Py.PyExpr -> ValidTraverserData -> Py.PyExpr
|
||||||
|
traverserValid e vtd =
|
||||||
|
case validBounds vtd of
|
||||||
|
Range f t ->
|
||||||
|
if validRev vtd
|
||||||
|
then Py.BinOp Py.GreaterThanEq e f
|
||||||
|
else Py.BinOp Py.LessThan e t
|
||||||
|
Random -> Py.BoolLiteral True
|
||||||
|
|
||||||
|
traverserStep :: String -> ValidTraverserData -> Py.PyStmt
|
||||||
|
traverserStep s vtd =
|
||||||
|
case validBounds vtd of
|
||||||
|
Range _ _ -> Py.Assign (Py.VarPat s) $ Py.BinOp op (Py.Var s) (Py.IntLiteral 1)
|
||||||
|
where op = if validRev vtd then Py.Subtract else Py.Add
|
||||||
|
Random -> traverserRandom s $ validList vtd
|
||||||
|
|
||||||
|
traverserRandom :: String -> String -> Py.PyStmt
|
||||||
|
traverserRandom s l =
|
||||||
|
Py.Assign (Py.VarPat s) $ Py.FunctionCall (Py.Var "random.randrange")
|
||||||
|
[Py.FunctionCall (Py.Var "len") [Py.Var l]]
|
||||||
|
|
||||||
|
hasVar :: String -> Py.PyPat -> Bool
|
||||||
|
hasVar s (Py.VarPat s') = s == s'
|
||||||
|
hasVar s (Py.TuplePat ps) = any (hasVar s) ps
|
||||||
|
hasVar s _ = False
|
||||||
|
|
||||||
|
substituteVariable :: String -> Py.PyExpr -> Py.PyExpr -> Py.PyExpr
|
||||||
|
substituteVariable s e (Py.BinOp o l r) =
|
||||||
|
Py.BinOp o (substituteVariable s e l) (substituteVariable s e r)
|
||||||
|
substituteVariable s e (Py.ListLiteral es) =
|
||||||
|
Py.ListLiteral $ map (substituteVariable s e) es
|
||||||
|
substituteVariable s e (Py.DictLiteral es) =
|
||||||
|
Py.DictLiteral $
|
||||||
|
map (first (substituteVariable s e) . second (substituteVariable s e)) es
|
||||||
|
substituteVariable s e (Py.Lambda ps e') =
|
||||||
|
Py.Lambda ps $ if any (hasVar s) ps then substituteVariable s e e' else e'
|
||||||
|
substituteVariable s e (Py.Var s')
|
||||||
|
| s == s' = e
|
||||||
|
| otherwise = Py.Var s'
|
||||||
|
substituteVariable s e (Py.TupleLiteral es) =
|
||||||
|
Py.TupleLiteral $ map (substituteVariable s e) es
|
||||||
|
substituteVariable s e (Py.FunctionCall e' es) =
|
||||||
|
Py.FunctionCall (substituteVariable s e e') $
|
||||||
|
map (substituteVariable s e) es
|
||||||
|
substituteVariable s e (Py.Access e' es) =
|
||||||
|
Py.Access (substituteVariable s e e') $
|
||||||
|
map (substituteVariable s e) es
|
||||||
|
substituteVariable s e (Py.Ternary i t e') =
|
||||||
|
Py.Ternary (substituteVariable s e i) (substituteVariable s e t)
|
||||||
|
(substituteVariable s e e')
|
||||||
|
substituteVariable s e (Py.Member e' m) =
|
||||||
|
Py.Member (substituteVariable s e e') m
|
||||||
|
substituteVariable s e (Py.In e1 e2) =
|
||||||
|
Py.In (substituteVariable s e e1) (substituteVariable s e e2)
|
||||||
|
substituteVariable s e (Py.NotIn e1 e2) =
|
||||||
|
Py.NotIn (substituteVariable s e e1) (substituteVariable s e e2)
|
||||||
|
substituteVariable s e (Py.Slice f t) =
|
||||||
|
Py.Slice (substituteVariable s e <$> f) (substituteVariable s e <$> t)
|
||||||
|
|
||||||
|
translateExpr :: Expr -> Translator Py.PyExpr
|
||||||
|
translateExpr (TraverserCall "pop" [Var s]) = do
|
||||||
|
l <- validList <$> requireTraverser s
|
||||||
|
return $ Py.FunctionCall (Py.Member (Py.Var l) "pop") [Py.Var s]
|
||||||
|
translateExpr (TraverserCall "pos" [Var s]) = do
|
||||||
|
requireTraverser s
|
||||||
|
return $ Py.Var s
|
||||||
|
translateExpr (TraverserCall "at" [Var s]) = do
|
||||||
|
l <- validList <$> requireTraverser s
|
||||||
|
return $ Py.Access (Py.Var l) [Py.Var s]
|
||||||
|
translateExpr (TraverserCall "at" [Var s, IntLiteral i]) = do
|
||||||
|
vtd <- requireTraverser s
|
||||||
|
return $ Py.Access (Py.Var $ validList vtd)
|
||||||
|
[traverserIncrement (validRev vtd) (Py.IntLiteral i) (Py.Var s)]
|
||||||
|
translateExpr (TraverserCall "step" [Var s]) = do
|
||||||
|
vtd <- requireTraverser s
|
||||||
|
emitStatement $ traverserStep s vtd
|
||||||
|
return $ Py.IntLiteral 0
|
||||||
|
translateExpr (TraverserCall "canstep" [Var s]) = do
|
||||||
|
vtd <- requireTraverser s
|
||||||
|
return $
|
||||||
|
traverserValid
|
||||||
|
(traverserIncrement (validRev vtd) (Py.IntLiteral 1) (Py.Var s)) vtd
|
||||||
|
translateExpr (TraverserCall "valid" [Var s]) = do
|
||||||
|
vtd <- requireTraverser s
|
||||||
|
return $ traverserValid (Py.Var s) vtd
|
||||||
|
translateExpr (TraverserCall "subset" [Var s1, Var s2]) = do
|
||||||
|
l1 <- validList <$> requireTraverser s1
|
||||||
|
l2 <- validList <$> requireTraverser s2
|
||||||
|
if l1 == l2
|
||||||
|
then return $ Py.Access (Py.Var l1) [Py.Slice (Just $ Py.Var s1) (Just $ Py.Var s2)]
|
||||||
|
else fail "Incompatible traversers!"
|
||||||
|
translateExpr (TraverserCall "bisect" [Var s, Lambda [x] e]) = do
|
||||||
|
vtd <- requireTraverser s
|
||||||
|
newTemp <- freshTemp
|
||||||
|
lambdaExpr <- translateExpr e
|
||||||
|
let access = Py.Access (Py.Var $ validList vtd) [Py.Var s]
|
||||||
|
let translated = substituteVariable x access lambdaExpr
|
||||||
|
let append s = Py.FunctionCall (Py.Member (Py.Var s) "append") [ access ]
|
||||||
|
let bisectStmt = Py.FunctionDef newTemp []
|
||||||
|
[ Py.Nonlocal [s]
|
||||||
|
, Py.Assign (Py.VarPat "l") (Py.ListLiteral [])
|
||||||
|
, Py.Assign (Py.VarPat "r") (Py.ListLiteral [])
|
||||||
|
, Py.While (traverserValid (Py.Var s) vtd)
|
||||||
|
[ Py.IfElse translated
|
||||||
|
[ Py.Standalone $ append "l" ]
|
||||||
|
[]
|
||||||
|
(Just [ Py.Standalone $ append "r" ])
|
||||||
|
, traverserStep s vtd
|
||||||
|
]
|
||||||
|
, Py.Return $ Py.TupleLiteral [Py.Var "l", Py.Var "r"]
|
||||||
|
]
|
||||||
|
emitStatement bisectStmt
|
||||||
|
return $ Py.FunctionCall (Py.Var newTemp) []
|
||||||
|
translateExpr (TraverserCall _ _) = fail "Invalid traverser operation"
|
||||||
|
translateExpr (FunctionCall f ps) = do
|
||||||
|
pes <- mapM translateExpr ps
|
||||||
|
return $ Py.FunctionCall (Py.Var f) pes
|
||||||
|
translateExpr (BinOp o l r) =
|
||||||
|
Py.BinOp (translateOp o) <$> translateExpr l <*> translateExpr r
|
||||||
|
translateExpr (Lambda ps e) =
|
||||||
|
Py.Lambda (map Py.VarPat ps) <$> translateExpr e
|
||||||
|
translateExpr (Var s) = return $ Py.Var s
|
||||||
|
translateExpr (IntLiteral i) = return $ Py.IntLiteral i
|
||||||
|
translateExpr (BoolLiteral b) = return $ Py.BoolLiteral b
|
||||||
|
translateExpr (ListLiteral es) = Py.ListLiteral <$> mapM translateExpr es
|
||||||
|
translateExpr (TupleLiteral es) = Py.TupleLiteral <$> mapM translateExpr es
|
||||||
|
|
||||||
|
applyOption :: TraverserData -> (String, Py.PyExpr) -> Maybe TraverserData
|
||||||
|
applyOption td ("list", Py.Var s) =
|
||||||
|
return $ td { list = Just s }
|
||||||
|
applyOption td ("span", Py.TupleLiteral [f, t]) =
|
||||||
|
return $ td { bounds = Just $ Range f t }
|
||||||
|
applyOption td ("random", Py.BoolLiteral True) =
|
||||||
|
return $ td { bounds = Just Random }
|
||||||
|
applyOption td ("reverse", Py.BoolLiteral b) =
|
||||||
|
return $ td { rev = b }
|
||||||
|
applyOption td _ = Nothing
|
||||||
|
|
||||||
|
translateOption :: (String, Expr) -> Translator (String, Py.PyExpr)
|
||||||
|
translateOption (s, e) = (,) s <$> translateExpr e
|
||||||
|
|
||||||
|
defaultTraverser :: TraverserData
|
||||||
|
defaultTraverser =
|
||||||
|
TraverserData { list = Nothing, bounds = Nothing, rev = False }
|
||||||
|
|
||||||
|
translateBranch :: Branch -> Translator (Py.PyExpr, [Py.PyStmt])
|
||||||
|
translateBranch (e, s) = (,) <$> translateExpr e <*>
|
||||||
|
(concat <$> mapM (withdrawStatements . translateStmt) s)
|
||||||
|
|
||||||
|
translateStmt :: Stmt -> Translator Py.PyStmt
|
||||||
|
translateStmt (IfElse i els e) = uncurry Py.IfElse
|
||||||
|
<$> (translateBranch i) <*> (mapM translateBranch els) <*> convertElse e
|
||||||
|
where
|
||||||
|
convertElse [] = return Nothing
|
||||||
|
convertElse es = Just . concat <$>
|
||||||
|
mapM (withdrawStatements . translateStmt) es
|
||||||
|
translateStmt (While b) = uncurry Py.While <$> translateBranch b
|
||||||
|
translateStmt (Traverser s os) =
|
||||||
|
foldlM applyOption defaultTraverser <$> mapM translateOption os >>= saveTraverser
|
||||||
|
where
|
||||||
|
saveTraverser :: Maybe TraverserData -> Translator Py.PyStmt
|
||||||
|
saveTraverser (Just (td@TraverserData { list = Just l, bounds = Just bs})) =
|
||||||
|
putTraverser s vtd $> translateInitialBounds s vtd
|
||||||
|
where
|
||||||
|
vtd = ValidTraverserData
|
||||||
|
{ validList = l
|
||||||
|
, validBounds = bs
|
||||||
|
, validRev = rev td
|
||||||
|
}
|
||||||
|
saveTraverser Nothing = fail "Invalid traverser (!)"
|
||||||
|
translateStmt (Let p e) = Py.Assign <$> translatePat p <*> translateExpr e
|
||||||
|
translateStmt (Return e) = Py.Return <$> translateExpr e
|
||||||
|
translateStmt (Standalone e) = Py.Standalone <$> translateExpr e
|
||||||
|
|
||||||
|
translateInitialBounds :: String -> ValidTraverserData -> Py.PyStmt
|
||||||
|
translateInitialBounds s vtd =
|
||||||
|
case (validBounds vtd, validRev vtd) of
|
||||||
|
(Random, _) -> traverserRandom s $ validList vtd
|
||||||
|
(Range l _, False) -> Py.Assign (Py.VarPat s) l
|
||||||
|
(Range _ r, True) -> Py.Assign (Py.VarPat s) r
|
||||||
|
|
||||||
|
translatePat :: Pat -> Translator Py.PyPat
|
||||||
|
translatePat (VarPat s) = clearTraverser s $> Py.VarPat s
|
||||||
|
translatePat (TuplePat ts) = Py.TuplePat <$> mapM translatePat ts
|
||||||
|
|
||||||
|
translateOp :: Op -> Py.PyBinOp
|
||||||
|
translateOp Add = Py.Add
|
||||||
|
translateOp Subtract = Py.Subtract
|
||||||
|
translateOp Multiply = Py.Multiply
|
||||||
|
translateOp Divide = Py.Divide
|
||||||
|
translateOp LessThan = Py.LessThan
|
||||||
|
translateOp LessThanEqual = Py.LessThanEq
|
||||||
|
translateOp GreaterThan = Py.GreaterThan
|
||||||
|
translateOp GreaterThanEqual = Py.GreaterThanEq
|
||||||
|
translateOp Equal = Py.Equal
|
||||||
|
translateOp NotEqual = Py.NotEqual
|
||||||
|
translateOp And = Py.And
|
||||||
|
translateOp Or = Py.Or
|
||||||
|
|
||||||
|
translateFunction :: Function -> [Py.PyStmt]
|
||||||
|
translateFunction (Function m s ps ss) = return $ Py.FunctionDef s ps $
|
||||||
|
[ Py.Standalone $ Py.FunctionCall (Py.Member (Py.Var p) "sort") []
|
||||||
|
| p <- take 1 ps, m == Sorted ] ++ stmts
|
||||||
|
where
|
||||||
|
stmts = concat $ evalState
|
||||||
|
(mapM (withdrawStatements . translateStmt) ss) (Map.empty, [], 0)
|
||||||
|
|
||||||
|
translate :: Prog -> [Py.PyStmt]
|
||||||
|
translate (Prog fs) =
|
||||||
|
(Py.FromImport "bisect" ["bisect"]) :
|
||||||
|
(Py.Import "random") : concatMap translateFunction fs
|
||||||
198
code/cs325-langs/src/LanguageTwo.hs
Normal file
198
code/cs325-langs/src/LanguageTwo.hs
Normal file
@@ -0,0 +1,198 @@
|
|||||||
|
module LanguageTwo where
|
||||||
|
import qualified PythonAst as Py
|
||||||
|
import qualified CommonParsing as P
|
||||||
|
import Data.Char
|
||||||
|
import Data.Functor
|
||||||
|
import Text.Parsec
|
||||||
|
import Text.Parsec.Char
|
||||||
|
import Text.Parsec.Combinator
|
||||||
|
|
||||||
|
{- Data Types -}
|
||||||
|
data Op
|
||||||
|
= Add
|
||||||
|
| Subtract
|
||||||
|
| Multiply
|
||||||
|
| Divide
|
||||||
|
| Equal
|
||||||
|
| NotEqual
|
||||||
|
| And
|
||||||
|
| Or
|
||||||
|
|
||||||
|
data Expr
|
||||||
|
= IntLiteral Int
|
||||||
|
| BinOp Op Expr Expr
|
||||||
|
| Var String
|
||||||
|
| Length Expr
|
||||||
|
|
||||||
|
data Stmt
|
||||||
|
= IfElse Expr Stmt (Maybe Stmt)
|
||||||
|
| Assign String Expr
|
||||||
|
| Block [Stmt]
|
||||||
|
|
||||||
|
data Prog = Prog Expr [Stmt] [Stmt]
|
||||||
|
|
||||||
|
{- Parser -}
|
||||||
|
type Parser = Parsec String ()
|
||||||
|
|
||||||
|
parseVar :: Parser String
|
||||||
|
parseVar = P.var [ "if", "else", "state", "effect", "combine" ]
|
||||||
|
|
||||||
|
parseLength :: Parser Expr
|
||||||
|
parseLength = Length <$> P.surround '|' '|' parseExpr
|
||||||
|
|
||||||
|
parseParenthesized :: Parser Expr
|
||||||
|
parseParenthesized = P.surround '(' ')' parseExpr
|
||||||
|
|
||||||
|
parseBasic :: Parser Expr
|
||||||
|
parseBasic = choice
|
||||||
|
[ IntLiteral <$> P.int
|
||||||
|
, Var <$> parseVar
|
||||||
|
, parseLength
|
||||||
|
, parseParenthesized
|
||||||
|
]
|
||||||
|
|
||||||
|
|
||||||
|
parseExpr :: Parser Expr
|
||||||
|
parseExpr = P.precedence BinOp parseBasic
|
||||||
|
[ P.op "*" Multiply <|> P.op "/" Divide
|
||||||
|
, P.op "+" Add <|> P.op "-" Subtract
|
||||||
|
, P.op "==" Equal <|> P.op "!=" NotEqual
|
||||||
|
, P.op "&&" And
|
||||||
|
, try $ P.op "||" Or
|
||||||
|
]
|
||||||
|
|
||||||
|
parseIf :: Parser Stmt
|
||||||
|
parseIf = do
|
||||||
|
P.kwIf >> spaces
|
||||||
|
c <- parseParenthesized
|
||||||
|
t <- parseStmt <* spaces
|
||||||
|
e <- (Just <$> (P.kwElse >> spaces *> parseStmt)) <|> return Nothing
|
||||||
|
return $ IfElse c t e
|
||||||
|
|
||||||
|
parseBlockStmts :: Parser [Stmt]
|
||||||
|
parseBlockStmts = P.surround '{' '}' (many parseStmt)
|
||||||
|
|
||||||
|
parseBlock :: Parser Stmt
|
||||||
|
parseBlock = Block <$> parseBlockStmts
|
||||||
|
|
||||||
|
parseAssign :: Parser Stmt
|
||||||
|
parseAssign = Assign <$>
|
||||||
|
(parseVar <* char '=' <* spaces) <*>
|
||||||
|
parseExpr <* (char ';' >> spaces)
|
||||||
|
|
||||||
|
parseStmt :: Parser Stmt
|
||||||
|
parseStmt = choice
|
||||||
|
[ parseIf
|
||||||
|
, parseAssign
|
||||||
|
, parseBlock
|
||||||
|
]
|
||||||
|
|
||||||
|
parseProgram :: Parser Prog
|
||||||
|
parseProgram = do
|
||||||
|
state <- P.kwState >> spaces *> parseExpr <* char ';' <* spaces
|
||||||
|
effect <- P.kwEffect >> spaces *> parseBlockStmts <* spaces
|
||||||
|
combined <- P.kwCombine >> spaces *> parseBlockStmts <* spaces
|
||||||
|
return $ Prog state effect combined
|
||||||
|
|
||||||
|
parse :: String -> String -> Either ParseError Prog
|
||||||
|
parse = runParser parseProgram ()
|
||||||
|
|
||||||
|
{- Translation -}
|
||||||
|
baseFunction :: Py.PyExpr -> [Py.PyStmt] -> [Py.PyStmt] -> Py.PyStmt
|
||||||
|
baseFunction s e c = Py.FunctionDef "prog" ["xs"] $
|
||||||
|
[Py.IfElse
|
||||||
|
(Py.BinOp Py.LessThan
|
||||||
|
(Py.FunctionCall (Py.Var "len") [Py.Var "xs"])
|
||||||
|
(Py.IntLiteral 2))
|
||||||
|
[Py.Return $ Py.Tuple [s, Py.Var "xs"]]
|
||||||
|
[]
|
||||||
|
Nothing
|
||||||
|
, Py.Assign (Py.VarPat "leng")
|
||||||
|
(Py.BinOp Py.FloorDiv
|
||||||
|
(Py.FunctionCall (Py.Var "len") [Py.Var "xs"])
|
||||||
|
(Py.IntLiteral 2))
|
||||||
|
, Py.Assign (Py.VarPat "left")
|
||||||
|
(Py.Access
|
||||||
|
(Py.Var "xs")
|
||||||
|
[Py.Slice Nothing $ Just (Py.Var "leng")])
|
||||||
|
, Py.Assign (Py.VarPat "right")
|
||||||
|
(Py.Access
|
||||||
|
(Py.Var "xs")
|
||||||
|
[Py.Slice (Just (Py.Var "leng")) Nothing])
|
||||||
|
, Py.Assign (Py.TuplePat [Py.VarPat "ls", Py.VarPat "left"])
|
||||||
|
(Py.FunctionCall (Py.Var "prog") [Py.Var "left"])
|
||||||
|
, Py.Assign (Py.TuplePat [Py.VarPat "rs", Py.VarPat "right"])
|
||||||
|
(Py.FunctionCall (Py.Var "prog") [Py.Var "right"])
|
||||||
|
, Py.Standalone $
|
||||||
|
Py.FunctionCall (Py.Member (Py.Var "left") "reverse") []
|
||||||
|
, Py.Standalone $
|
||||||
|
Py.FunctionCall (Py.Member (Py.Var "right") "reverse") []
|
||||||
|
, Py.Assign (Py.VarPat "state") s
|
||||||
|
, Py.Assign (Py.VarPat "source") (Py.IntLiteral 0)
|
||||||
|
, Py.Assign (Py.VarPat "total") (Py.ListLiteral [])
|
||||||
|
, Py.While
|
||||||
|
(Py.BinOp Py.And
|
||||||
|
(Py.BinOp Py.NotEqual (Py.Var "left") (Py.ListLiteral []))
|
||||||
|
(Py.BinOp Py.NotEqual (Py.Var "right") (Py.ListLiteral []))) $
|
||||||
|
[ Py.IfElse
|
||||||
|
(Py.BinOp Py.LessThanEq
|
||||||
|
(Py.Access (Py.Var "left") [Py.IntLiteral $ -1])
|
||||||
|
(Py.Access (Py.Var "right") [Py.IntLiteral $ -1]))
|
||||||
|
[ Py.Standalone $
|
||||||
|
Py.FunctionCall (Py.Member (Py.Var "total") "append")
|
||||||
|
[Py.FunctionCall (Py.Member (Py.Var "left") "pop") []]
|
||||||
|
, Py.Assign (Py.VarPat "source") (Py.IntLiteral 1)
|
||||||
|
]
|
||||||
|
[] $
|
||||||
|
Just
|
||||||
|
[ Py.Standalone $
|
||||||
|
Py.FunctionCall (Py.Member (Py.Var "total") "append")
|
||||||
|
[Py.FunctionCall (Py.Member (Py.Var "right") "pop") []]
|
||||||
|
, Py.Assign (Py.VarPat "source") (Py.IntLiteral 2)
|
||||||
|
]
|
||||||
|
] ++ e
|
||||||
|
] ++ c ++
|
||||||
|
[ Py.Standalone $ Py.FunctionCall (Py.Member (Py.Var "left") "reverse") []
|
||||||
|
, Py.Standalone $ Py.FunctionCall (Py.Member (Py.Var "right") "reverse") []
|
||||||
|
, Py.Return $ Py.Tuple
|
||||||
|
[ Py.Var "state"
|
||||||
|
, foldl (Py.BinOp Py.Add) (Py.Var "total") [Py.Var "left", Py.Var "right"]
|
||||||
|
]
|
||||||
|
]
|
||||||
|
|
||||||
|
translateExpr :: Expr -> Py.PyExpr
|
||||||
|
translateExpr (IntLiteral i) = Py.IntLiteral i
|
||||||
|
translateExpr (BinOp op l r) =
|
||||||
|
Py.BinOp (translateOp op) (translateExpr l) (translateExpr r)
|
||||||
|
translateExpr (Var s)
|
||||||
|
| s == "SOURCE" = Py.Var "source"
|
||||||
|
| s == "LEFT" = Py.Var "left"
|
||||||
|
| s == "RIGHT" = Py.Var "right"
|
||||||
|
| s == "STATE" = Py.Var "state"
|
||||||
|
| s == "LSTATE" = Py.Var "ls"
|
||||||
|
| s == "RSTATE" = Py.Var "rs"
|
||||||
|
| s == "L" = Py.IntLiteral 1
|
||||||
|
| s == "R" = Py.IntLiteral 2
|
||||||
|
| otherwise = Py.Var s
|
||||||
|
translateExpr (Length e) = Py.FunctionCall (Py.Var "len") [translateExpr e]
|
||||||
|
|
||||||
|
translateOp :: Op -> Py.PyBinOp
|
||||||
|
translateOp Add = Py.Add
|
||||||
|
translateOp Subtract = Py.Subtract
|
||||||
|
translateOp Multiply = Py.Multiply
|
||||||
|
translateOp Divide = Py.Divide
|
||||||
|
translateOp Equal = Py.Equal
|
||||||
|
translateOp NotEqual = Py.NotEqual
|
||||||
|
translateOp And = Py.And
|
||||||
|
translateOp Or = Py.Or
|
||||||
|
|
||||||
|
translateStmt :: Stmt -> [Py.PyStmt]
|
||||||
|
translateStmt (IfElse c t e) =
|
||||||
|
[Py.IfElse (translateExpr c) (translateStmt t) [] (translateStmt <$> e)]
|
||||||
|
translateStmt (Assign "STATE" e) = [Py.Assign (Py.VarPat "state") (translateExpr e)]
|
||||||
|
translateStmt (Assign v e) = [Py.Assign (Py.VarPat v) (translateExpr e)]
|
||||||
|
translateStmt (Block s) = concatMap translateStmt s
|
||||||
|
|
||||||
|
translate :: Prog -> [Py.PyStmt]
|
||||||
|
translate (Prog s e c) =
|
||||||
|
[baseFunction (translateExpr s) (concatMap translateStmt e) (concatMap translateStmt c)]
|
||||||
52
code/cs325-langs/src/PythonAst.hs
Normal file
52
code/cs325-langs/src/PythonAst.hs
Normal file
@@ -0,0 +1,52 @@
|
|||||||
|
module PythonAst where
|
||||||
|
|
||||||
|
data PyBinOp
|
||||||
|
= Add
|
||||||
|
| Subtract
|
||||||
|
| Multiply
|
||||||
|
| Divide
|
||||||
|
| FloorDiv
|
||||||
|
| LessThan
|
||||||
|
| LessThanEq
|
||||||
|
| GreaterThan
|
||||||
|
| GreaterThanEq
|
||||||
|
| Equal
|
||||||
|
| NotEqual
|
||||||
|
| And
|
||||||
|
| Or
|
||||||
|
|
||||||
|
data PyExpr
|
||||||
|
= BinOp PyBinOp PyExpr PyExpr
|
||||||
|
| IntLiteral Int
|
||||||
|
| StrLiteral String
|
||||||
|
| BoolLiteral Bool
|
||||||
|
| ListLiteral [PyExpr]
|
||||||
|
| DictLiteral [(PyExpr, PyExpr)]
|
||||||
|
| Lambda [PyPat] PyExpr
|
||||||
|
| Var String
|
||||||
|
| TupleLiteral [PyExpr]
|
||||||
|
| FunctionCall PyExpr [PyExpr]
|
||||||
|
| Access PyExpr [PyExpr]
|
||||||
|
| Ternary PyExpr PyExpr PyExpr
|
||||||
|
| Member PyExpr String
|
||||||
|
| In PyExpr PyExpr
|
||||||
|
| NotIn PyExpr PyExpr
|
||||||
|
| Slice (Maybe PyExpr) (Maybe PyExpr)
|
||||||
|
|
||||||
|
data PyPat
|
||||||
|
= VarPat String
|
||||||
|
| IgnorePat
|
||||||
|
| TuplePat [PyPat]
|
||||||
|
| AccessPat PyExpr [PyExpr]
|
||||||
|
|
||||||
|
data PyStmt
|
||||||
|
= Assign PyPat PyExpr
|
||||||
|
| IfElse PyExpr [PyStmt] [(PyExpr, [PyStmt])] (Maybe [PyStmt])
|
||||||
|
| While PyExpr [PyStmt]
|
||||||
|
| For PyPat PyExpr [PyStmt]
|
||||||
|
| FunctionDef String [String] [PyStmt]
|
||||||
|
| Return PyExpr
|
||||||
|
| Standalone PyExpr
|
||||||
|
| Import String
|
||||||
|
| FromImport String [String]
|
||||||
|
| Nonlocal [String]
|
||||||
142
code/cs325-langs/src/PythonGen.hs
Normal file
142
code/cs325-langs/src/PythonGen.hs
Normal file
@@ -0,0 +1,142 @@
|
|||||||
|
module PythonGen where
|
||||||
|
import PythonAst
|
||||||
|
import Data.List
|
||||||
|
import Data.Bifunctor
|
||||||
|
import Data.Maybe
|
||||||
|
|
||||||
|
indent :: String -> String
|
||||||
|
indent = (" " ++)
|
||||||
|
|
||||||
|
stmtBlock :: [PyStmt] -> [String]
|
||||||
|
stmtBlock = concatMap translateStmt
|
||||||
|
|
||||||
|
block :: String -> [String] -> [String]
|
||||||
|
block s ss = (s ++ ":") : map indent ss
|
||||||
|
|
||||||
|
prefix :: String -> PyExpr -> [PyStmt] -> [String]
|
||||||
|
prefix s e sts = block (s ++ " " ++ translateExpr e) $ stmtBlock sts
|
||||||
|
|
||||||
|
if_ :: PyExpr -> [PyStmt] -> [String]
|
||||||
|
if_ = prefix "if"
|
||||||
|
|
||||||
|
elif :: PyExpr -> [PyStmt] -> [String]
|
||||||
|
elif = prefix "elif"
|
||||||
|
|
||||||
|
else_ :: [PyStmt] -> [String]
|
||||||
|
else_ = block "else" . stmtBlock
|
||||||
|
|
||||||
|
while :: PyExpr -> [PyStmt] -> [String]
|
||||||
|
while = prefix "while"
|
||||||
|
|
||||||
|
parenth :: String -> String
|
||||||
|
parenth s = "(" ++ s ++ ")"
|
||||||
|
|
||||||
|
translateStmt :: PyStmt -> [String]
|
||||||
|
translateStmt (Assign p e) = [translatePat p ++ " = " ++ translateExpr e]
|
||||||
|
translateStmt (IfElse i t es e) =
|
||||||
|
if_ i t ++ concatMap (uncurry elif) es ++ maybe [] else_ e
|
||||||
|
translateStmt (While c t) = while c t
|
||||||
|
translateStmt (For x in_ b) = block head body
|
||||||
|
where
|
||||||
|
head = "for " ++ translatePat x ++ " in " ++ translateExpr in_
|
||||||
|
body = stmtBlock b
|
||||||
|
translateStmt (FunctionDef s ps b) = block head body
|
||||||
|
where
|
||||||
|
head = "def " ++ s ++ "(" ++ intercalate "," ps ++ ")"
|
||||||
|
body = stmtBlock b
|
||||||
|
translateStmt (Return e) = ["return " ++ translateExpr e]
|
||||||
|
translateStmt (Standalone e) = [translateExpr e]
|
||||||
|
translateStmt (Import s) = ["import " ++ s]
|
||||||
|
translateStmt (FromImport s ss) =
|
||||||
|
["from " ++ s ++ " import " ++ intercalate "," ss]
|
||||||
|
translateStmt (Nonlocal vs) =
|
||||||
|
["nonlocal " ++ intercalate "," vs]
|
||||||
|
|
||||||
|
precedence :: PyBinOp -> Int
|
||||||
|
precedence Add = 3
|
||||||
|
precedence Subtract = 3
|
||||||
|
precedence Multiply = 4
|
||||||
|
precedence Divide = 4
|
||||||
|
precedence FloorDiv = 4
|
||||||
|
precedence LessThan = 2
|
||||||
|
precedence LessThanEq = 2
|
||||||
|
precedence GreaterThan = 2
|
||||||
|
precedence GreaterThanEq = 2
|
||||||
|
precedence Equal = 2
|
||||||
|
precedence NotEqual = 2
|
||||||
|
precedence And = 1
|
||||||
|
precedence Or = 0
|
||||||
|
|
||||||
|
opString :: PyBinOp -> String
|
||||||
|
opString Add = "+"
|
||||||
|
opString Subtract = "-"
|
||||||
|
opString Multiply = "*"
|
||||||
|
opString Divide = "/"
|
||||||
|
opString FloorDiv = "//"
|
||||||
|
opString LessThan = "<"
|
||||||
|
opString LessThanEq = "<="
|
||||||
|
opString GreaterThan = ">"
|
||||||
|
opString GreaterThanEq = ">="
|
||||||
|
opString Equal = "=="
|
||||||
|
opString NotEqual = "!="
|
||||||
|
opString And = " and "
|
||||||
|
opString Or = " or "
|
||||||
|
|
||||||
|
translateOp :: PyBinOp -> PyBinOp -> PyExpr -> String
|
||||||
|
translateOp o o' =
|
||||||
|
if precedence o > precedence o'
|
||||||
|
then parenth . translateExpr
|
||||||
|
else translateExpr
|
||||||
|
|
||||||
|
dictMapping :: PyExpr -> PyExpr -> String
|
||||||
|
dictMapping f t = translateExpr f ++ ": " ++ translateExpr t
|
||||||
|
|
||||||
|
list :: String -> String -> [PyExpr] -> String
|
||||||
|
list o c es = o ++ intercalate ", " (map translateExpr es) ++ c
|
||||||
|
|
||||||
|
translateExpr :: PyExpr -> String
|
||||||
|
translateExpr (BinOp o l@(BinOp o1 _ _) r@(BinOp o2 _ _)) =
|
||||||
|
translateOp o o1 l ++ opString o ++ translateOp o o2 r
|
||||||
|
translateExpr (BinOp o l@(BinOp o1 _ _) r) =
|
||||||
|
translateOp o o1 l ++ opString o ++ translateExpr r
|
||||||
|
translateExpr (BinOp o l r@(BinOp o2 _ _)) =
|
||||||
|
translateExpr l ++ opString o ++ translateOp o o2 r
|
||||||
|
translateExpr (BinOp o l r) =
|
||||||
|
translateExpr l ++ opString o ++ translateExpr r
|
||||||
|
translateExpr (IntLiteral i) = show i
|
||||||
|
translateExpr (StrLiteral s) = "\"" ++ s ++ "\""
|
||||||
|
translateExpr (BoolLiteral b) = if b then "true" else "false"
|
||||||
|
translateExpr (ListLiteral l) = list "[" "]" l
|
||||||
|
translateExpr (DictLiteral l) =
|
||||||
|
"{" ++ intercalate ", " (map (uncurry dictMapping) l) ++ "}"
|
||||||
|
translateExpr (Lambda ps e) = parenth (head ++ ": " ++ body)
|
||||||
|
where
|
||||||
|
head = "lambda " ++ intercalate ", " (map translatePat ps)
|
||||||
|
body = translateExpr e
|
||||||
|
translateExpr (Var s) = s
|
||||||
|
translateExpr (TupleLiteral es) = list "(" ")" es
|
||||||
|
translateExpr (FunctionCall f ps) = translateExpr f ++ list "(" ")" ps
|
||||||
|
translateExpr (Access (Var s) e) = s ++ list "[" "]" e
|
||||||
|
translateExpr (Access e@Access{} i) = translateExpr e ++ list "[" "]" i
|
||||||
|
translateExpr (Access e i) = "(" ++ translateExpr e ++ ")" ++ list "[" "]" i
|
||||||
|
translateExpr (Ternary c t e) =
|
||||||
|
translateExpr t ++ " if " ++ translateExpr c ++ " else " ++ translateExpr e
|
||||||
|
translateExpr (Member (Var s) m) = s ++ "." ++ m
|
||||||
|
translateExpr (Member e@Member{} m) = translateExpr e ++ "." ++ m
|
||||||
|
translateExpr (Member e m) = "(" ++ translateExpr e ++ ")." ++ m
|
||||||
|
translateExpr (In m c) =
|
||||||
|
"(" ++ translateExpr m ++ ") in (" ++ translateExpr c ++ ")"
|
||||||
|
translateExpr (NotIn m c) =
|
||||||
|
"(" ++ translateExpr m ++ ") not in (" ++ translateExpr c ++ ")"
|
||||||
|
translateExpr (Slice l r) =
|
||||||
|
maybe [] (parenth . translateExpr) l ++ ":" ++ maybe [] (parenth . translateExpr) r
|
||||||
|
|
||||||
|
translatePat :: PyPat -> String
|
||||||
|
translatePat (VarPat s) = s
|
||||||
|
translatePat IgnorePat = "_"
|
||||||
|
translatePat (TuplePat ps) =
|
||||||
|
"(" ++ intercalate "," (map translatePat ps) ++ ")"
|
||||||
|
translatePat (AccessPat e es) = translateExpr (Access e es)
|
||||||
|
|
||||||
|
translate :: [PyStmt] -> String
|
||||||
|
translate = intercalate "\n" . concatMap translateStmt
|
||||||
@@ -2,5 +2,5 @@
|
|||||||
title: Daniel's Blog
|
title: Daniel's Blog
|
||||||
---
|
---
|
||||||
## Hello!
|
## Hello!
|
||||||
Welcome to my blog. Here, I write abour various subjects, including (but not limited to)
|
Welcome to my blog. Here, I write about various subjects, including (but not limited to)
|
||||||
functional programming, compiler development, programming language theory, and occasionally video games. I hope you find something useful here!
|
functional programming, compiler development, programming language theory, and occasionally video games. I hope you find something useful here!
|
||||||
|
|||||||
511
content/blog/00_cs325_languages_hw1.md
Normal file
511
content/blog/00_cs325_languages_hw1.md
Normal file
@@ -0,0 +1,511 @@
|
|||||||
|
---
|
||||||
|
title: A Language for an Assignment - Homework 1
|
||||||
|
date: 2019-12-27T23:27:09-08:00
|
||||||
|
tags: ["Haskell", "Python", "Algorithms"]
|
||||||
|
---
|
||||||
|
|
||||||
|
On a rainy Oregon day, I was walking between classes with a group of friends.
|
||||||
|
We were discussing the various ways to obfuscate solutions to the weekly
|
||||||
|
homework assignments in our Algorithms course: replace every `if` with
|
||||||
|
a ternary expression, use single variable names, put everything on one line.
|
||||||
|
I said:
|
||||||
|
|
||||||
|
> The
|
||||||
|
{{< sidenote "right" "chad-note" "chad" >}}
|
||||||
|
This is in reference to a meme, <a href="https://knowyourmeme.com/memes/virgin-vs-chad">Virgin vs Chad</a>.
|
||||||
|
A "chad" characteristic is masculine or "alpha" to the point of absurdity.
|
||||||
|
{{< /sidenote >}} move would be to make your own, different language for every homework assignment.
|
||||||
|
|
||||||
|
It was required of us to use
|
||||||
|
{{< sidenote "left" "python-note" "Python" >}}
|
||||||
|
A friend suggested making a Haskell program
|
||||||
|
that generates Python-based interpreters for languages. While that would be truly
|
||||||
|
absurd, I'll leave <em>this</em> challenge for another day.
|
||||||
|
{{< /sidenote >}} for our solutions, so that was the first limitation on this challenge.
|
||||||
|
Someone suggested to write the languages in Haskell, since that's what we used
|
||||||
|
in our Programming Languages class. So the final goal ended up:
|
||||||
|
|
||||||
|
* For each of the 10 homework assignments in CS325 - Analysis of Algorithms,
|
||||||
|
* Create a Haskell program that translates a language into,
|
||||||
|
* A valid Python program that works (nearly) out of the box and passes all the test cases.
|
||||||
|
|
||||||
|
It may not be worth it to create a whole
|
||||||
|
{{< sidenote "right" "general-purpose-note" "general-purpose" >}}
|
||||||
|
A general purpose language is one that's designed to be used in various
|
||||||
|
domains. For instance, C++ is a general-purpose language because it can
|
||||||
|
be used for embedded systems, GUI programs, and pretty much anything else.
|
||||||
|
This is in contrast to a domain-specific language, such as Game Maker Language,
|
||||||
|
which is aimed at a much narrower set of uses.
|
||||||
|
{{< /sidenote >}} language for each problem,
|
||||||
|
but nowhere in the challenge did we say that it had to be general-purpose. In
|
||||||
|
fact, some interesting design thinking can go into designing a domain-specific
|
||||||
|
language for a particular assignment. So let's jump right into it, and make
|
||||||
|
a language for the first homework assignment.
|
||||||
|
|
||||||
|
### Homework 1
|
||||||
|
There are two problems in Homework 1. Here they are, verbatim:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/hws/hw1.txt" 32 38 >}}
|
||||||
|
|
||||||
|
And the second:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/hws/hw1.txt" 47 68 >}}
|
||||||
|
|
||||||
|
We want to make a language __specifically__ for these two tasks (one of which
|
||||||
|
is split into many tasks). What common things can we isolate? I see two:
|
||||||
|
|
||||||
|
First, __all the problems deal with lists__. This may seem like a trivial observation,
|
||||||
|
but these two problems are the __only__ thing we use our language for. We have
|
||||||
|
list access,
|
||||||
|
{{< sidenote "right" "filterting-note" "list filtering" >}}
|
||||||
|
Quickselect is a variation on quicksort, which itself
|
||||||
|
finds all the "lesser" and "greater" elements in the input array.
|
||||||
|
{{< /sidenote >}} and list creation. That should serve as a good base!
|
||||||
|
|
||||||
|
If you squint a little bit, __all the problems are recursive with the same base case__.
|
||||||
|
Consider the first few lines of `search`, implemented naively:
|
||||||
|
|
||||||
|
```Python
|
||||||
|
def search(xs, k):
|
||||||
|
if xs == []:
|
||||||
|
return false
|
||||||
|
```
|
||||||
|
|
||||||
|
How about `sorted`? Take a look:
|
||||||
|
|
||||||
|
```Python
|
||||||
|
def sorted(xs):
|
||||||
|
if xs == []:
|
||||||
|
return []
|
||||||
|
```
|
||||||
|
|
||||||
|
I'm sure you see the picture. But it will take some real mental gymnastics to twist the
|
||||||
|
rest of the problems into this shape. What about `qselect`, for instance? There's two
|
||||||
|
cases for what it may return:
|
||||||
|
|
||||||
|
* `None` or equivalent if the index is out of bounds (we give it `4` an a list `[1, 2]`).
|
||||||
|
* A number if `qselect` worked.
|
||||||
|
|
||||||
|
The test cases never provide a concrete example of what should be returned from
|
||||||
|
`qselect` in the first case, so we'll interpret it like
|
||||||
|
{{< sidenote "right" "undefined-note" "undefined behavior" >}}
|
||||||
|
For a quick sidenote about undefined behavior, check out how
|
||||||
|
C++ optimizes the <a href="https://godbolt.org/z/3skK9j">Collatz Conjecture function</a>.
|
||||||
|
Clang doesn't know whether or not the function will terminate (whether the Collatz Conjecture
|
||||||
|
function terminates is an <a href="https://en.wikipedia.org/wiki/Collatz_conjecture">unsolved problem</a>),
|
||||||
|
but functions that don't terminate are undefined behavior. There's only one other way the function
|
||||||
|
returns, and that's with "1". Thus, clang optimizes the entire function to a single "return 1" call.
|
||||||
|
{{< /sidenote >}} in C++:
|
||||||
|
we can do whatever we want. So, let's allow it to return `[]` in the `None` case.
|
||||||
|
This makes this base case valid:
|
||||||
|
|
||||||
|
```Python
|
||||||
|
def qselect(xs, k):
|
||||||
|
if xs == []:
|
||||||
|
return []
|
||||||
|
```
|
||||||
|
|
||||||
|
"Oh yeah, now it's all coming together." With one more observation (which will come
|
||||||
|
from a piece I haven't yet shown you!), we'll be able to generalize this base case.
|
||||||
|
|
||||||
|
The observation is this section in the assignment:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/hws/hw1.txt" 83 98 >}}
|
||||||
|
|
||||||
|
The real key is the part about "returning the `[]` where x should be inserted". It so
|
||||||
|
happens that when the list given to the function is empty, the number should be inserted
|
||||||
|
precisely into that list. Thus:
|
||||||
|
|
||||||
|
```Python
|
||||||
|
def _search(xs, k):
|
||||||
|
if xs == []:
|
||||||
|
return xs
|
||||||
|
```
|
||||||
|
|
||||||
|
The same works for `qselect`:
|
||||||
|
|
||||||
|
```Python
|
||||||
|
def qselect(xs, k):
|
||||||
|
if xs == []:
|
||||||
|
return xs
|
||||||
|
```
|
||||||
|
|
||||||
|
And for sorted, too:
|
||||||
|
|
||||||
|
```Python
|
||||||
|
def sorted(xs):
|
||||||
|
if xs == []:
|
||||||
|
return xs
|
||||||
|
```
|
||||||
|
|
||||||
|
There are some functions that are exceptions, though:
|
||||||
|
|
||||||
|
```Python
|
||||||
|
def insert(xs, k):
|
||||||
|
# We can't return early here!
|
||||||
|
# If we do, we'll never insert anything.
|
||||||
|
```
|
||||||
|
|
||||||
|
Also:
|
||||||
|
|
||||||
|
```Python
|
||||||
|
def search(xs, k):
|
||||||
|
# We have to return true or false, never
|
||||||
|
# an empty list.
|
||||||
|
```
|
||||||
|
|
||||||
|
So, whenever we __don't__ return a list, we don't want to add a special case.
|
||||||
|
We arrive at the following common base case: __whenever a function returns a list, if its first argument
|
||||||
|
is the empty list, the first argument is immediately returned__.
|
||||||
|
|
||||||
|
We've largely exhasuted the conclusiosn we can draw from these problems. Let's get to designing a language.
|
||||||
|
|
||||||
|
### A Silly Language
|
||||||
|
Let's start by visualizing our goals. Without base cases, the solution to `_search`
|
||||||
|
would be something like this:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/sols/hw1.lang" 11 14 >}}
|
||||||
|
|
||||||
|
Here we have an __`if`-expression__. It has to have an `else`, and evaluates to the value
|
||||||
|
of the chosen branch. That is, `if true then 0 else 1` evaluates to `0`, while
|
||||||
|
`if false then 0 else 1` evaluates to `1`. Otherwise, we follow the binary tree search
|
||||||
|
algorithm faithfully.
|
||||||
|
|
||||||
|
Using this definition of `_search`, we can define `search` pretty easily:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/sols/hw1.lang" 17 17 >}}
|
||||||
|
|
||||||
|
Let's use Haskell's `(++)` operator for concatentation. This will help us understand
|
||||||
|
when the user is operating on lists, and when they're not. With this, `sorted` becomes:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/sols/hw1.lang" 16 16 >}}
|
||||||
|
|
||||||
|
Let's go for `qselect` now. We'll introduce a very silly language feature for this
|
||||||
|
problem:
|
||||||
|
{{< sidenote "right" "selector-note" "list selectors" >}}
|
||||||
|
You've probably never heard of list selectors, and for a good reason:
|
||||||
|
this is a <em>terrible</em> language feature. I'll go in more detail
|
||||||
|
later, but I wanted to make this clear right away.
|
||||||
|
{{< /sidenote >}}. We observe that `qselect` aims to partition the list into
|
||||||
|
other lists. We thus add the following pieces of syntax:
|
||||||
|
|
||||||
|
```
|
||||||
|
~xs -> {
|
||||||
|
pivot <- xs[rand]!
|
||||||
|
left <- xs[#0 <= pivot]
|
||||||
|
...
|
||||||
|
} -> ...
|
||||||
|
```
|
||||||
|
|
||||||
|
There are three new things here.
|
||||||
|
|
||||||
|
1. The actual "list selector": `~xs -> { .. } -> ...`. Between the curly braces
|
||||||
|
are branches which select parts of the list and assign them to new variables.
|
||||||
|
Thus, `pivot <- xs[rand]!` assigns the element at a random index to the variable `pivot`.
|
||||||
|
the `!` at the end means "after taking this out of `xs`, delete it from `xs`". The
|
||||||
|
syntax {{< sidenote "right" "curly-note" "starts with \"~\"" >}}
|
||||||
|
An observant reader will note that there's no need for the "xs" after the "~".
|
||||||
|
The idea was to add a special case syntax to reference the "selected list", but
|
||||||
|
I ended up not bothering. So in fact, this part of the syntax is useless.
|
||||||
|
{{< /sidenote >}} to make it easier to parse.
|
||||||
|
2. The `rand` list access syntax. `xs[rand]` is a special case that picks a random
|
||||||
|
element from `xs`.
|
||||||
|
3. The `xs[#0 <= pivot]` syntax. This is another special case that selects all elements
|
||||||
|
from `xs` that match the given predicate (where `#0` is replaced with each element in `xs`).
|
||||||
|
|
||||||
|
The big part of qselect is to not evaluate `right` unless you have to. So, we shouldn't
|
||||||
|
eagerly evaluate the list selector. We also don't want something like `right[|right|-1]` to evaluate
|
||||||
|
`right` twice. So we settle on
|
||||||
|
{{< sidenote "right" "lazy-note" "lazy evaluation" >}}
|
||||||
|
Lazy evaluation means only evaluating an expression when we need to. Thus,
|
||||||
|
although we might encounter the expression for <code>right</code>, we
|
||||||
|
only evaluate it when the time comes. Lazy evaluation, at least
|
||||||
|
the way that Haskell has it, is more specific: an expression is evaluated only
|
||||||
|
once, or not at all.
|
||||||
|
{{</ sidenote >}}.
|
||||||
|
Ah, but the `!` marker introduces
|
||||||
|
{{< sidenote "left" "side-effect-note" "side effects" >}}
|
||||||
|
A side effect is a term frequently used when talking about functional programming.
|
||||||
|
Evaluating the expression <code>xs[rand]!</code> doesn't just get a random element,
|
||||||
|
it also changes <em>something else</em>. In this case, that something else is
|
||||||
|
the <code>xs</code> list.
|
||||||
|
{{< /sidenote >}}. So we can't just evaluate these things all willy-nilly.
|
||||||
|
So, let's make it so that each expression in the selector list requires the ones above it. Thus,
|
||||||
|
`left` will require `pivot`, and `right` will require `left` and `pivot`. So,
|
||||||
|
lazily evaluated, ordered expressions. The whole `qselect` becomes:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/sols/hw1.lang" 1 9 >}}
|
||||||
|
|
||||||
|
We've now figured out all the language constructs. Let's start working on
|
||||||
|
some implementation!
|
||||||
|
|
||||||
|
#### Implementation
|
||||||
|
It would be silly of me to explain every detail of creating a language in Haskell
|
||||||
|
in this post; this is neither the purpose of the post, nor is it plausible
|
||||||
|
to do this without covering monads, parser combinators, grammars, abstract syntax
|
||||||
|
trees, and more. So, instead, I'll discuss the _interesting_ parts of the
|
||||||
|
implementation.
|
||||||
|
|
||||||
|
##### Temporary Variables
|
||||||
|
Our language is expression-based, yes. A function is a single,
|
||||||
|
arbitrarily complex expression (involving `if/else`, list
|
||||||
|
selectors, and more). So it would make sense to translate
|
||||||
|
a function to a single, arbitrarily complex Python expression.
|
||||||
|
However, the way we've designed our language makes it
|
||||||
|
not-so-suitable for converting to a single expression! For
|
||||||
|
instance, consider `xs[rand]`. We need to compute the list,
|
||||||
|
get its length, generate a random number, and then access
|
||||||
|
the corresponding element in the list. We use the list
|
||||||
|
here twice, and simply repeating the expression would not
|
||||||
|
be very smart: we'd be evaluating twice. So instead,
|
||||||
|
we'll use a variable, assign the list to that variable,
|
||||||
|
and then access that variable multiple times.
|
||||||
|
|
||||||
|
To be extra safe, let's use a fresh temporary variable
|
||||||
|
every time we need to store something. The simplest
|
||||||
|
way is to simply maintain a counter of how many temporary
|
||||||
|
variables we've already used, and generate a new variable
|
||||||
|
by prepending the word "temp" to that number. We start
|
||||||
|
with `temp0`, then `temp1`, and so on. To keep a counter,
|
||||||
|
we can use a state monad:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 230 230 >}}
|
||||||
|
|
||||||
|
Don't worry about the `Map.Map String [String]`, we'll get to that in a bit.
|
||||||
|
For now, all we have to worry about is the second element of the tuple,
|
||||||
|
the integer counting how many temporary variables we've used. We can
|
||||||
|
get the current temporary variable as follows:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 232 235 >}}
|
||||||
|
|
||||||
|
We can also get a fresh temporary variable like this:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 237 240 >}}
|
||||||
|
|
||||||
|
Now, the
|
||||||
|
{{< sidenote "left" "code-note" "code" >}}
|
||||||
|
Since we are translating an expression, we must have the result of
|
||||||
|
the translation yield an Python expression we can use in generating
|
||||||
|
larger Python expressions. However, as we've seen, we occasionally
|
||||||
|
have to use statements. Thus, the <code>translateExpr</code> function
|
||||||
|
returns a <code>Translator ([Py.PyStmt], Py.PyExpr)</code>.
|
||||||
|
{{< /sidenote >}}for generating a random list access looks like
|
||||||
|
{{< sidenote "right" "ast-note" "this:" >}}
|
||||||
|
The <code>Py.*</code> constructors are a part of a Python AST module I quickly
|
||||||
|
threw together. I won't showcase it here, but you can always look at the
|
||||||
|
source code for the blog (which includes this project)
|
||||||
|
<a href="https://dev.danilafe.com/Web-Projects/blog-static">here</a>.
|
||||||
|
{{< /sidenote >}}
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 325 330 >}}
|
||||||
|
|
||||||
|
##### Implementing "lazy evaluation"
|
||||||
|
Lazy evaluation in functional programs usually arises from
|
||||||
|
{{< sidenote "right" "graph-note" "graph reduction" >}}
|
||||||
|
Graph reduction, more specifically the <em>Spineless,
|
||||||
|
Tagless G-machine</em> is at the core of the Glasgow Haskell
|
||||||
|
Compiler (GHC). Simon Peyton Jones' earlier book,
|
||||||
|
<em>Implementing Functional Languages: a tutorial</em>
|
||||||
|
details an earlier version of the G-machine.
|
||||||
|
{{< /sidenote >}}. However, Python is neither
|
||||||
|
functional nor graph-based, and we only lazily
|
||||||
|
evaluate list selectors. Thus, we'll have to do
|
||||||
|
some work to get our lazy evaluation to work as we desire.
|
||||||
|
Here's what I came up with:
|
||||||
|
|
||||||
|
1. It's difficult to insert Python statements where they are
|
||||||
|
needed: we'd have to figure out in which scope each variable
|
||||||
|
has already been declared, and in which scope it's yet
|
||||||
|
to be assigned.
|
||||||
|
2. Instead, we can use a Python dictionary, called `cache`,
|
||||||
|
and store computed versions of each variable in the cache.
|
||||||
|
3. It's pretty difficult to check if a variable
|
||||||
|
is in the cache, compute it if not, and then return the
|
||||||
|
result of the computation, in one expression. This is
|
||||||
|
true, unless that single expression is a function call, and we have a dedicated
|
||||||
|
function that takes no arguments, computes the expression if needed,
|
||||||
|
and uses the cache otherwise. We choose this route.
|
||||||
|
4. We have already promised that we'd evaluate all the selected
|
||||||
|
variables above a given variable before evaluating the variable
|
||||||
|
itself. So, each function will first call (and therefore
|
||||||
|
{{< sidenote "right" "force-note" "force" >}}
|
||||||
|
Forcing, in this case, comes from the context of lazy evaluation. To
|
||||||
|
force a variable or an expression is to tell the program to compute its
|
||||||
|
value, even though it may have been putting it off.
|
||||||
|
{{< /sidenote >}}) the functions
|
||||||
|
generated for variables declared above the function's own variable.
|
||||||
|
5. To keep track of all of this, we use the already-existing state monad
|
||||||
|
as a reader monad (that is, we clear the changes we make to the monad
|
||||||
|
after we're done translating the list selector). This is where the `Map.Map String [String]`
|
||||||
|
comes from.
|
||||||
|
|
||||||
|
The `Map.Map String [String]` keeps track of variables that will be lazily computed,
|
||||||
|
and also of the dependencies of each variable (the variables that need
|
||||||
|
to be access before the variable itself). We compute such a map for
|
||||||
|
each selector as follows:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 298 298 >}}
|
||||||
|
|
||||||
|
We update the existing map using `Map.union`:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 299 299 >}}
|
||||||
|
|
||||||
|
And, after we're done generating expressions in the body of this selector,
|
||||||
|
we clear it to its previous value `vs`:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 302 302 >}}
|
||||||
|
|
||||||
|
We generate a single selector as follows:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 268 281 >}}
|
||||||
|
|
||||||
|
This generates a function definition statement, which we will examine in
|
||||||
|
generated Python code later on.
|
||||||
|
|
||||||
|
Solving the problem this way also introduces another gotcha: sometimes,
|
||||||
|
a variable is produced by a function call, and other times the variable
|
||||||
|
is just a Python variable. We write this as follows:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 283 288 >}}
|
||||||
|
|
||||||
|
##### Special Case Insertion
|
||||||
|
This is a silly language for a single homework assignment. I'm not
|
||||||
|
planning to implement Hindley-Milner type inference, or anything
|
||||||
|
of that sort. For the purpose of this language, things will be
|
||||||
|
either a list, or not a list. And as long as a function __can__ return
|
||||||
|
a list, it can also return the list from its base case. Thus,
|
||||||
|
that's all we will try to figure out. The checking code is so
|
||||||
|
short that we can include the whole snippet at once:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 219 227 >}}
|
||||||
|
|
||||||
|
`mergePossibleType`
|
||||||
|
{{< sidenote "right" "bool-identity-note" "figures out" >}}
|
||||||
|
An observant reader will note that this is just a logical
|
||||||
|
OR function. It's not, however, good practice to use
|
||||||
|
booleans for types that have two constructors with no arguments.
|
||||||
|
Check out this <a href="https://programming-elm.com/blog/2019-05-20-solving-the-boolean-identity-crisis-part-1/">
|
||||||
|
Elm-based article</a> about this, which the author calls the
|
||||||
|
Boolean Identity Crisis.
|
||||||
|
{{< /sidenote >}}, given two possible types for an
|
||||||
|
expression, the final type for the expression.
|
||||||
|
|
||||||
|
There's only one real trick to this. Sometimes, like in
|
||||||
|
`_search`, the only time we return something _known_ to be a list, that
|
||||||
|
something is `xs`. Since we're making a list manipulation language,
|
||||||
|
let's __assume the first argument to the function is a list__, and
|
||||||
|
__use this information to determine expression types__. We guess
|
||||||
|
types in a very basic manner otherwise: If you use the concatenation
|
||||||
|
operator, or a list literal, then obviously we're working on a list.
|
||||||
|
If you're returning the first argument of the function, that's also
|
||||||
|
a list. Otherwise, it could be anything.
|
||||||
|
|
||||||
|
My Haskell linter actually suggested a pretty clever way of writing
|
||||||
|
the whole "add a base case if this function returns a list" code.
|
||||||
|
Check it out:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageOne.hs" 260 266 >}}
|
||||||
|
|
||||||
|
Specifically, look at the line with `let fastReturn = ...`. It
|
||||||
|
uses a list comprehension: we take a parameter `p` from the list of
|
||||||
|
parameter `ps`, but only produce the statements for the base case
|
||||||
|
if the possible type computed using `p` is `List`.
|
||||||
|
|
||||||
|
### The Output
|
||||||
|
What kind of beast have we created? Take a look for yourself:
|
||||||
|
```Python
|
||||||
|
def qselect(xs,k):
|
||||||
|
if xs==[]:
|
||||||
|
return xs
|
||||||
|
cache = {}
|
||||||
|
def pivot():
|
||||||
|
if ("pivot") not in (cache):
|
||||||
|
cache["pivot"] = xs.pop(0)
|
||||||
|
return cache["pivot"]
|
||||||
|
def left():
|
||||||
|
def temp2(arg):
|
||||||
|
out = []
|
||||||
|
for arg0 in arg:
|
||||||
|
if arg0<=pivot():
|
||||||
|
out.append(arg0)
|
||||||
|
return out
|
||||||
|
pivot()
|
||||||
|
if ("left") not in (cache):
|
||||||
|
cache["left"] = temp2(xs)
|
||||||
|
return cache["left"]
|
||||||
|
def right():
|
||||||
|
def temp3(arg):
|
||||||
|
out = []
|
||||||
|
for arg0 in arg:
|
||||||
|
if arg0>pivot():
|
||||||
|
out.append(arg0)
|
||||||
|
return out
|
||||||
|
left()
|
||||||
|
pivot()
|
||||||
|
if ("right") not in (cache):
|
||||||
|
cache["right"] = temp3(xs)
|
||||||
|
return cache["right"]
|
||||||
|
if k>(len(left())+1):
|
||||||
|
temp4 = qselect(right(), k-len(left())-1)
|
||||||
|
else:
|
||||||
|
if k==(len(left())+1):
|
||||||
|
temp5 = [pivot()]
|
||||||
|
else:
|
||||||
|
temp5 = qselect(left(), k)
|
||||||
|
temp4 = temp5
|
||||||
|
return temp4
|
||||||
|
def _search(xs,k):
|
||||||
|
if xs==[]:
|
||||||
|
return xs
|
||||||
|
if xs[1]==k:
|
||||||
|
temp6 = xs
|
||||||
|
else:
|
||||||
|
if xs[1]>k:
|
||||||
|
temp8 = _search(xs[0], k)
|
||||||
|
else:
|
||||||
|
temp8 = _search(xs[2], k)
|
||||||
|
temp6 = temp8
|
||||||
|
return temp6
|
||||||
|
def sorted(xs):
|
||||||
|
if xs==[]:
|
||||||
|
return xs
|
||||||
|
return sorted(xs[0])+[xs[1]]+sorted(xs[2])
|
||||||
|
def search(xs,k):
|
||||||
|
return len(_search(xs, k))!=0
|
||||||
|
def insert(xs,k):
|
||||||
|
return _insert(k, _search(xs, k))
|
||||||
|
def _insert(k,xs):
|
||||||
|
if k==[]:
|
||||||
|
return k
|
||||||
|
if len(xs)==0:
|
||||||
|
temp16 = xs
|
||||||
|
temp16.append([])
|
||||||
|
temp17 = temp16
|
||||||
|
temp17.append(k)
|
||||||
|
temp18 = temp17
|
||||||
|
temp18.append([])
|
||||||
|
temp15 = temp18
|
||||||
|
else:
|
||||||
|
temp15 = xs
|
||||||
|
return temp15
|
||||||
|
```
|
||||||
|
It's...horrible! All the `tempX` variables, __three layers of nested function declarations__, hardcoded cache access. This is not something you'd ever want to write.
|
||||||
|
Even to get this code, I had to come up with hacks __in a language I created__.
|
||||||
|
The first is the hack is to make the `qselect` function use the `xs == []` base
|
||||||
|
case. This doesn't happen by default, because `qselect` doesn't return a list!
|
||||||
|
To "fix" this, I made `qselect` return the number it found, wrapped in a
|
||||||
|
list literal. This is not up to spec, and would require another function
|
||||||
|
to unwrap this list.
|
||||||
|
|
||||||
|
While `qselect` was struggling with not having the base case, `insert` had
|
||||||
|
a base case it didn't need: `insert` shouldn't return the list itself
|
||||||
|
when it's empty, it should insert into it! However, when we use the `<<`
|
||||||
|
list insertion operator, the language infers `insert` to be a list-returning
|
||||||
|
function itself, inserting into an empty list will always fail. So, we
|
||||||
|
make a function `_insert`, which __takes the arguments in reverse__.
|
||||||
|
The base case will still be generated, but the first argument (against
|
||||||
|
which the base case is checked) will be a number, so the `k == []` check
|
||||||
|
will always fail.
|
||||||
|
|
||||||
|
That concludes this post. I'll be working on more solutions to homework
|
||||||
|
assignments in self-made languages, so keep an eye out!
|
||||||
218
content/blog/01_cs325_languages_hw2.md
Normal file
218
content/blog/01_cs325_languages_hw2.md
Normal file
@@ -0,0 +1,218 @@
|
|||||||
|
---
|
||||||
|
title: A Language for an Assignment - Homework 2
|
||||||
|
date: 2019-12-30T20:05:10-08:00
|
||||||
|
tags: ["Haskell", "Python", "Algorithms"]
|
||||||
|
---
|
||||||
|
|
||||||
|
After the madness of the
|
||||||
|
[language for homework 1]({{< relref "00_cs325_languages_hw1.md" >}}),
|
||||||
|
the solution to the second homework offers a moment of respite.
|
||||||
|
Let's get right into the problems, shall we?
|
||||||
|
|
||||||
|
### Homework 2
|
||||||
|
Besides some free-response questions, the homework contains
|
||||||
|
two problems. The first:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/hws/hw2.txt" 29 34 >}}
|
||||||
|
|
||||||
|
And the second:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/hws/hw2.txt" 36 44 >}}
|
||||||
|
|
||||||
|
At first glance, it's not obvious why these problems are good for
|
||||||
|
us. However, there's one key observation: __`num_inversions` can be implemented
|
||||||
|
using a slightly-modified `mergesort`__. The trick is to maintain a counter
|
||||||
|
of inversions in every recursive call to `mergesort`, updating
|
||||||
|
it every time we take an element from the
|
||||||
|
{{< sidenote "right" "right-note" "right list" >}}
|
||||||
|
If this nomenclature is not clear to you, recall that
|
||||||
|
mergesort divides a list into two smaller lists. The
|
||||||
|
"right list" refers to the second of the two, because
|
||||||
|
if you visualize the original list as a rectangle, and cut
|
||||||
|
it in half (vertically, down the middle), then the second list
|
||||||
|
(from the left) is on the right.
|
||||||
|
{{< /sidenote >}} while there are still elements in the
|
||||||
|
{{< sidenote "left" "left-note" "left list" >}}
|
||||||
|
Why this is the case is left as an exercise to the reader.
|
||||||
|
{{< /sidenote >}}.
|
||||||
|
When we return from the call,
|
||||||
|
we add up the number of inversions from running `num_inversions`
|
||||||
|
on the smaller lists, and the number of inversions that we counted
|
||||||
|
as I described. We then return both the total number
|
||||||
|
of inversions and the sorted list.
|
||||||
|
|
||||||
|
So, we either perform the standard mergesort, or we perform mergesort
|
||||||
|
with additional steps added on. The additional steps can be divided into
|
||||||
|
three general categories:
|
||||||
|
|
||||||
|
1. __Initialization__: We create / set some initial state. This state
|
||||||
|
doesn't depend on the lists or anything else.
|
||||||
|
2. __Effect__: Each time that an element is moved from one of the two smaller
|
||||||
|
lists into the output list, we may change the state in some way (create
|
||||||
|
an effect).
|
||||||
|
3. __Combination__: The final state, and the results of the two
|
||||||
|
sub-problem states, are combined into the output of the function.
|
||||||
|
|
||||||
|
This is all very abstract. In the concrete case of inversions,
|
||||||
|
these steps are as follows:
|
||||||
|
|
||||||
|
1. __Initializtion__: The initial state, which is just the counter, is set to 0.
|
||||||
|
2. __Effect__: Each time an element is moved, if it comes from the right list,
|
||||||
|
the number of inversions is updated.
|
||||||
|
3. __Combination__: We update the state, simply adding the left and right
|
||||||
|
inversion counts.
|
||||||
|
|
||||||
|
We can make a language out of this!
|
||||||
|
|
||||||
|
### A Language
|
||||||
|
Again, let's start by visualizing what the solution will look like. How about this:
|
||||||
|
|
||||||
|
{{< rawblock "cs325-langs/sols/hw2.lang" >}}
|
||||||
|
|
||||||
|
We divide the code into the same three steps that we described above. The first
|
||||||
|
section is the initial state. Since it doesn't depend on anything, we expect
|
||||||
|
it to be some kind of literal, like an integer. Next, we have the effect section,
|
||||||
|
which has access to the variables below:
|
||||||
|
|
||||||
|
* `STATE`, to manipulate or check the current state.
|
||||||
|
* `LEFT` and `RIGHT`, to access the two lists being merged.
|
||||||
|
* `L` and `R`, constants that are used to compare against the `SOURCE` variable.
|
||||||
|
* `SOURCE`, to denote which list a number came from.
|
||||||
|
* `LSTATE` and `RSTATE`, to denote the final states from the two subproblems.
|
||||||
|
|
||||||
|
We use an `if`-statement to check if the element that was popped came
|
||||||
|
from the right list (by checking `SOURCE == R`). If it did, we increment the counter
|
||||||
|
(state) by the proper amount. In the combine step, which has access to the
|
||||||
|
same variables, we simply increment the state by the counters from the left
|
||||||
|
and right solutions, stored in `LSTATE` and `RSTATE`. That's it!
|
||||||
|
|
||||||
|
#### Implementation
|
||||||
|
The implementation is not tricky at all. We don't need to use monads like we did last
|
||||||
|
time, and nor do we have to perform any fancy Python nested function declarations.
|
||||||
|
|
||||||
|
To keep with the Python convention of lowercase variables, we'll translate the
|
||||||
|
uppercase "global" variables to lowercase. We'll do it like so:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageTwo.hs" 167 176 >}}
|
||||||
|
|
||||||
|
Note that we translated `L` and `R` to integer literals. We'll indicate the source of
|
||||||
|
each element with an integer, since there's no real point to representing it with
|
||||||
|
a string or a variable. We'll need to be aware of this when we implement the actual, generic
|
||||||
|
mergesort code. Let's do that now:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageTwo.hs" 101 161 >}}
|
||||||
|
|
||||||
|
This is probably the ugliest part of this assignment: we handwrote a Python
|
||||||
|
AST in Haskell that implements mergesort with our augmentations. Note that
|
||||||
|
this is a function, which takes a `Py.PyExpr` (the initial state expression),
|
||||||
|
and two lists of `Py.PyStmt`, which are the "effect" and "combination" code,
|
||||||
|
respectively. We simply splice them into our regular mergesort function.
|
||||||
|
The translation is otherwise pretty trivial, so there's no real reason
|
||||||
|
to show it here.
|
||||||
|
|
||||||
|
### The Output
|
||||||
|
What's the output of our solution to `num_inversions`? Take a look for yourself:
|
||||||
|
|
||||||
|
```Python
|
||||||
|
def prog(xs):
|
||||||
|
if len(xs)<2:
|
||||||
|
return (0, xs)
|
||||||
|
leng = len(xs)//2
|
||||||
|
left = xs[:(leng)]
|
||||||
|
right = xs[(leng):]
|
||||||
|
(ls,left) = prog(left)
|
||||||
|
(rs,right) = prog(right)
|
||||||
|
left.reverse()
|
||||||
|
right.reverse()
|
||||||
|
state = 0
|
||||||
|
source = 0
|
||||||
|
total = []
|
||||||
|
while (left!=[])and(right!=[]):
|
||||||
|
if left[-1]<=right[-1]:
|
||||||
|
total.append(left.pop())
|
||||||
|
source = 1
|
||||||
|
else:
|
||||||
|
total.append(right.pop())
|
||||||
|
source = 2
|
||||||
|
if source==2:
|
||||||
|
state = state+len(left)
|
||||||
|
state = state+ls+rs
|
||||||
|
left.reverse()
|
||||||
|
right.reverse()
|
||||||
|
return (state, total+left+right)
|
||||||
|
```
|
||||||
|
|
||||||
|
Honestly, that's pretty clean. As clean as `left.reverse()` to allow for \\(O(1)\\) pop is.
|
||||||
|
What's really clean, however, is the implementation of mergesort in our language.
|
||||||
|
It goes as follows:
|
||||||
|
|
||||||
|
```
|
||||||
|
state 0;
|
||||||
|
effect {}
|
||||||
|
combine {}
|
||||||
|
```
|
||||||
|
|
||||||
|
To implement mergesort in our language, which describes mergesort variants, all
|
||||||
|
we have to do is not specify any additional behavior. Cool, huh?
|
||||||
|
|
||||||
|
That's the end of this post. If you liked this one (and the previous one!),
|
||||||
|
keep an eye out for more!
|
||||||
|
|
||||||
|
### Appendix (Missing Homework Question)
|
||||||
|
I should not view homework assignments on a small-screen device. There __was__ a third problem
|
||||||
|
on homework 2:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/hws/hw2.txt" 46 65 >}}
|
||||||
|
|
||||||
|
This is not a mergesort variant, and adding support for it into our second language
|
||||||
|
will prevent us from making it the neat specialized
|
||||||
|
{{< sidenote "right" "dsl-note" "DSL" >}}
|
||||||
|
DSL is a shortened form of "domain specific language", which was briefly
|
||||||
|
described in another sidenote while solving homework 1.
|
||||||
|
{{< /sidenote >}} that was just saw. We'll do something else, instead:
|
||||||
|
we'll use the language we defined in homework 1 to solve this
|
||||||
|
problem:
|
||||||
|
|
||||||
|
```
|
||||||
|
empty() = [0, 0];
|
||||||
|
longest(xs) =
|
||||||
|
if |xs| != 0
|
||||||
|
then _longest(longest(xs[0]), longest(xs[2]))
|
||||||
|
else empty();
|
||||||
|
_longest(l, r) = [max(l[0], r[0]) + 1, max(l[0]+r[0], max(l[1], r[1]))];
|
||||||
|
```
|
||||||
|
|
||||||
|
{{< sidenote "right" "terrible-note" "This is quite terrible." >}}
|
||||||
|
This is probably true with any program written in our first
|
||||||
|
language.
|
||||||
|
{{< /sidenote >}} In these 6 lines of code, there are two hacks
|
||||||
|
to work around the peculiarities of the language.
|
||||||
|
|
||||||
|
At each recursive call, we want to keep track of both the depth
|
||||||
|
of the tree and the existing longest path. This is because
|
||||||
|
the longest path could be found either somewhere down
|
||||||
|
a subtree, or from combining the largest depths of
|
||||||
|
two subtrees. To return two values from a function in Python,
|
||||||
|
we'd use a tuple. Here, we use a list.
|
||||||
|
|
||||||
|
Alarm bells should be going off here. There's no reason why we should
|
||||||
|
ever return an empty list from the recursive call: at the very least, we
|
||||||
|
want to return `[0,0]`. But placing such a list literal in a function
|
||||||
|
will trigger the special case insertion. So, we have to hide this literal
|
||||||
|
from the compiler. Fortunately, that's not too hard to do - the compiler
|
||||||
|
is pretty halfhearted in its inference of types. Simply putting
|
||||||
|
the literal behind a constant function (`empty`) does the trick.
|
||||||
|
|
||||||
|
The program uses the subproblem depths multiple times in the
|
||||||
|
final computation. We thus probably want to assign these values
|
||||||
|
to names so we don't have to perform any repeated work. Since
|
||||||
|
the only two mechanisms for
|
||||||
|
{{< sidenote "right" "binding-note" "binding variables" >}}
|
||||||
|
To bind a variable means to assign a value to it.
|
||||||
|
{{< /sidenote >}} in this language are function calls
|
||||||
|
and list selectors, we use a helper function `_longest`,
|
||||||
|
which takes two subproblem solutions an combines them
|
||||||
|
into a new solution. It's pretty obvious that `_longest`
|
||||||
|
returns a list, so the compiler will try insert a base
|
||||||
|
case. Fortunately, subproblem solutions are always
|
||||||
|
lists of two numbers, so this doesn't affect us too much.
|
||||||
429
content/blog/02_cs325_languages_hw3.md
Normal file
429
content/blog/02_cs325_languages_hw3.md
Normal file
@@ -0,0 +1,429 @@
|
|||||||
|
---
|
||||||
|
title: A Language for an Assignment - Homework 3
|
||||||
|
date: 2020-01-02T22:17:43-08:00
|
||||||
|
tags: ["Haskell", "Python", "Algorithms"]
|
||||||
|
---
|
||||||
|
|
||||||
|
It rained in Sunriver on New Year's Eve, and it continued to rain
|
||||||
|
for the next couple of days. So, instead of going skiing as planned,
|
||||||
|
to the dismay of my family and friends, I spent the majority of
|
||||||
|
those days working on the third language for homework 3. It
|
||||||
|
was quite the language, too - the homework has three problems, each of
|
||||||
|
which has a solution independent of the others. I invite you
|
||||||
|
to join me in my descent into madness as we construct another language.
|
||||||
|
|
||||||
|
### Homework 3
|
||||||
|
Let's take a look at the three homework problems. The first two are
|
||||||
|
related, but are solved using a different technique:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/hws/hw3.txt" 18 30 >}}
|
||||||
|
|
||||||
|
This problem requires us to find the `k` numbers closest to some
|
||||||
|
query (which I will call `n`) from a list `xs`. The list isn't sorted, and the
|
||||||
|
problem must run in linear time. Sorting the list would require
|
||||||
|
the standard
|
||||||
|
{{< sidenote "right" "n-note" "\(O(n\log n)\) time." >}}
|
||||||
|
The \(n\) in this expression is not the same as the query <code>n</code>,
|
||||||
|
but rather the length of the list. In fact, I have not yet assigned
|
||||||
|
the length of the input <code>xs</code> to any variable. If we say that
|
||||||
|
\(m\) is a number that denotes that length, the proper expression
|
||||||
|
for the complexity is \(O(m \log m)\).
|
||||||
|
{{< /sidenote >}} Thus, we have to take another route, which should
|
||||||
|
already be familiar: quickselect. Using quickselect, we can find the `k`th
|
||||||
|
closest number, and then collect all the numbers that are closer than the `kth`
|
||||||
|
closest number. So, we need a language that:
|
||||||
|
|
||||||
|
* Supports quickselect (and thus, list partitioning and recursion).
|
||||||
|
* Supports iteration, {{< sidenote "left" "iteration-note" "multiple times." >}}
|
||||||
|
Why would we need to iterate multiple times? Note that we could have a list
|
||||||
|
of numbers that are all the same, <code>[1,1,1,1,1]</code>. Then, we'll need
|
||||||
|
to know how many of the numbers <em>equally close</em> as the <code>k</code>th
|
||||||
|
element we need to include, which will require another pass through the list.
|
||||||
|
{{< /sidenote >}}
|
||||||
|
|
||||||
|
That's a good start. Let's take a look at the second problem:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/hws/hw3.txt" 33 47 >}}
|
||||||
|
|
||||||
|
This problem really is easier. We have to find the position of _the_ closest
|
||||||
|
element, and then try expand towards either the left or right, depending on
|
||||||
|
which end is better. This expansion will take several steps, and will
|
||||||
|
likely require a way to "look" at a given part of the list. So let's add two more
|
||||||
|
rules. We need a language that also:
|
||||||
|
|
||||||
|
* Supports looping control flow, such as `while`.
|
||||||
|
* {{< sidenote "right" "view-note" "Allows for a \"view\" into the list" >}}
|
||||||
|
We could, of course, simply use list indexing. But then, we'd just be making
|
||||||
|
a simple imperative language, and that's boring. So let's play around
|
||||||
|
with our design a little, and experimentally add such a "list view" component.
|
||||||
|
{{< /sidenote >}}
|
||||||
|
(like an abstraction over indexing).
|
||||||
|
|
||||||
|
This is shaping up to be a fun language. Let's take a look at the last problem:
|
||||||
|
{{< codelines "text" "cs325-langs/hws/hw3.txt" 50 64 >}}
|
||||||
|
|
||||||
|
This problem requires more iterations of a list. We have several
|
||||||
|
{{< sidenote "right" "cursor-note" "\"cursors\"" >}}
|
||||||
|
I always make the language before I write the post, since a lot of
|
||||||
|
design decisions change mid-implementation. I realize now that
|
||||||
|
"cursors" would've been a better name for this language feature,
|
||||||
|
but alas, it is too late.
|
||||||
|
{{< /sidenote >}} looking into the list, and depending if the values
|
||||||
|
at each of the cursors add up, we do or do not add a new tuple to a list. So,
|
||||||
|
two more requirements:
|
||||||
|
|
||||||
|
* The "cursors" must be able to interact.
|
||||||
|
* The language can represent {{< sidenote "left" "tuple-note" "tuples." >}}
|
||||||
|
We could, of course, hack some other way to return a list of tuples, but
|
||||||
|
it turns out tuples are pretty simple to implement, and help make for nicer
|
||||||
|
programming in our language.
|
||||||
|
{{< /sidenote >}}
|
||||||
|
|
||||||
|
I think we've gathered what we want from the homework. Let's move on to the
|
||||||
|
language!
|
||||||
|
|
||||||
|
### A Language
|
||||||
|
As is now usual, let's envision a solution to the problems in our language. There
|
||||||
|
are actually quite a lot of functions to look at, so let's see them one by one.
|
||||||
|
First, let's look at `qselect`.
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/sols/hw3.lang" 1 19 >}}
|
||||||
|
|
||||||
|
After the early return, the first interesting part of the language is the
|
||||||
|
use of what I have decided to call a __list traverser__. The list
|
||||||
|
traverser is a __generalization of a list index__. Whenever we use a list
|
||||||
|
index variable, we generally use the following operations:
|
||||||
|
|
||||||
|
* __Initialize__: we set the list index to some initial value, such as 0.
|
||||||
|
* __Step__: If we're walking the list from left to right, we increment the index.
|
||||||
|
If we're walking the list from right to left, we decrement the index.
|
||||||
|
* __Validity Check__: We check if the index is still valid (that is, we haven't
|
||||||
|
gone past the edge of the list).
|
||||||
|
* __Access__: Get the element the cursor is pointing to.
|
||||||
|
|
||||||
|
A {{< sidenote "right" "cpp-note" "traverser declaration" >}}
|
||||||
|
A fun fact is that we've just rediscovered C++
|
||||||
|
<a href="http://www.cplusplus.com/reference/iterator/">iterators</a>. C++
|
||||||
|
containers and their iterators provide us with the operations I described:
|
||||||
|
|
||||||
|
We can initialize an iterator like <code>auto it = list.begin()</code>. We
|
||||||
|
can step the iterator using <code>it++</code>. We can check its validity
|
||||||
|
using <code>it != list.end()</code>, and access what it's pointing to using
|
||||||
|
<code>*it</code>. While C++ uses templates and inheritance for this,
|
||||||
|
we define a language feature specifically for lists.
|
||||||
|
|
||||||
|
{{< /sidenote >}} describes these operations. The declartion for the `bisector`
|
||||||
|
traverser creates a "cursor" over the list `xs`, that goes between the 0th
|
||||||
|
and last elements of `xs`. The declaration for the `pivot` traverser creates
|
||||||
|
a "cursor" over the list `xs` that jumps around random locations in the list.
|
||||||
|
|
||||||
|
The next interesting part of the language is a __traverser macro__. This thing,
|
||||||
|
that looks like a function call (but isn't), performs an operation on the
|
||||||
|
cursor. For instance, `pop!` removes the element at the cursor from the list,
|
||||||
|
whereas `bisect!` categorizes the remaining elements in the cursor's list
|
||||||
|
into two lists, using a boolean-returning lambda (written in Java syntax).
|
||||||
|
|
||||||
|
Note that this implementation of `qselect` takes a function `c`, which it
|
||||||
|
uses to judge the actual value of the number. This is because our `qselect`
|
||||||
|
won't be finding _the_ smallest number, but the number with the smallest difference
|
||||||
|
with `n`. `n` will be factored in via the function.
|
||||||
|
|
||||||
|
Next up, let's take a look at the function that uses `qselect`, `closestUnsorted`:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/sols/hw3.lang" 21 46 >}}
|
||||||
|
|
||||||
|
Like we discussed, it finds the `k`th closest element (calling it `min`),
|
||||||
|
and counts how many elements that are __equal__ need to be included,
|
||||||
|
by setting the number to `k` at first, and subtracting 1 for every number
|
||||||
|
it encounters that's closer than `min`. Notice that we use the `valid!` and
|
||||||
|
`step!` macros, which implement the operations we described above. Notice
|
||||||
|
that the user doesn't deal with adding and subtracting numbers, and doing
|
||||||
|
comparisons. All they have to do is ask "am I still good to iterate?"
|
||||||
|
|
||||||
|
Next, let's take a look at `closestSorted`, which will require more
|
||||||
|
traverser macros.
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/sols/hw3.lang" 48 70 >}}
|
||||||
|
|
||||||
|
The first new macro is `canstep!`. This macro just verifies that
|
||||||
|
the traverser can make another step. We need this for the "reverse" iterator,
|
||||||
|
which indicates the lower bound of the range of numbers we want to return,
|
||||||
|
because `subset!` (which itself is just Python's slice, like `xs[a:b]`), uses an inclusive bottom
|
||||||
|
index, and thus, we can't afford to step it before knowing that we can, and that
|
||||||
|
it's a better choice after the step.
|
||||||
|
|
||||||
|
Similarly, we have the `at!(t, i)` macro, which looks at the
|
||||||
|
traverser `t`, with offset `i`.
|
||||||
|
|
||||||
|
We have two loops. The first loop runs as long as we can expand the range in both
|
||||||
|
directions, and picks the better direction at each iteration. The second loop
|
||||||
|
runs as long as we still want more numbers, but have already hit the edge
|
||||||
|
of the list on the left or on the right.
|
||||||
|
|
||||||
|
Finally, let's look at the solution to `xyz`:
|
||||||
|
|
||||||
|
{{< codelines "text" "cs325-langs/sols/hw3.lang" 72 95 >}}
|
||||||
|
|
||||||
|
I won't go in depth, but notice that the expression in the `span` part
|
||||||
|
of the `traverser` declaration can access another traverser. We treat
|
||||||
|
as a feature the fact that this expression isn't immediately evaluated at the place
|
||||||
|
of the traverser declaration. Rather, every time that a comparison for a traverser
|
||||||
|
operation is performed, this expression is re-evaluated. This allows us to put
|
||||||
|
dynamic bounds on traversers `y` and `z`, one of which must not exceed the other.
|
||||||
|
|
||||||
|
Note also a new keyword that was just used: `sorted`. This is a harmless little
|
||||||
|
language feature that automatically calls `.sort()` on the first argument of
|
||||||
|
the function.
|
||||||
|
|
||||||
|
This is more than enough to work with. Let's move on to the implementation.
|
||||||
|
|
||||||
|
#### Implementation
|
||||||
|
Again, let's not go too far into the details of implementing the language from scratch.
|
||||||
|
Instead, let's take a look into specific parts of the language that deserve attention.
|
||||||
|
|
||||||
|
##### Revenge of the State Monad
|
||||||
|
Our previous language was, indeed, a respite from complexity. Translation was
|
||||||
|
straightforward, and the resulting expressions and statements were plugged straight
|
||||||
|
into a handwritten AST. We cannot get away with this here; the language is powerful
|
||||||
|
enough to implement three list-based problems, which comes at the cost of increased
|
||||||
|
complexity.
|
||||||
|
|
||||||
|
We need, once again, to generate temporary variables. We also need to keep track of
|
||||||
|
which variables are traversers, and the properties of these traversers, throughout
|
||||||
|
each function of the language. We thus fall back to using `Control.Monad.State`:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageThree.hs" 198 198 >}}
|
||||||
|
|
||||||
|
There's one part of the state tuple that we haven't yet explained: the list of
|
||||||
|
statements.
|
||||||
|
|
||||||
|
##### Generating Statements
|
||||||
|
Recall that our translation function for expressions in the first homework had the type:
|
||||||
|
|
||||||
|
```Haskell
|
||||||
|
translateExpr :: Expr -> Translator ([Py.PyStmt], Py.PyExpr)
|
||||||
|
```
|
||||||
|
|
||||||
|
We then had to use `do`-notation, and explicitly concatenate lists
|
||||||
|
of emitted statements. In this language, I took an alternative route: I made
|
||||||
|
the statements part of the state. They are thus implicitly generated and
|
||||||
|
stored in the monad, and expression generators don't have to worry about
|
||||||
|
concatenating them. When the program is ready to use the generated statements
|
||||||
|
(say, when an `if`-statement needs to use the statements emitted by the condition
|
||||||
|
expression), we retrieve them from the monad:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageThree.hs" 228 234 >}}
|
||||||
|
|
||||||
|
I should note, for transparency, that there's a bug in my use of this function.
|
||||||
|
When I compile `if`-statements, I accidentally place statements generated by
|
||||||
|
the condition into the body of the `if`. This bug doesn't manifest
|
||||||
|
in the solutions to the homework problems, and so I decided not to spend any more
|
||||||
|
time on fixing it.
|
||||||
|
|
||||||
|
##### Validating Traverser Declarations
|
||||||
|
We declare two separate types that hold traverser data. The first is a kind of "draft"
|
||||||
|
type, `TraverserData`:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageThree.hs" 184 190 >}}
|
||||||
|
|
||||||
|
This record holds all possible configurations of a traverser
|
||||||
|
that occur as the program is iterating through the various `key: value` pairs in
|
||||||
|
the declaration. For instance, at the very beginning of processing a traverser declaration,
|
||||||
|
our program will use a "default" `TraverserData`, with all fields set to `Nothing` or
|
||||||
|
their default value. This value will then be modified by the first key/value pair,
|
||||||
|
changing, for instance, the list that the traverser operates on. This new modified
|
||||||
|
`TraverserData` will then be modified by the next key/value pair, and so on. Doing
|
||||||
|
this with every key/value pair (called an option in the below snippet)
|
||||||
|
is effectively a foldl operation.
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageThree.hs" 378 387 >}}
|
||||||
|
|
||||||
|
The data may not have all the required fields until the very end, and its type
|
||||||
|
reflects that: `Maybe String` here, `Maybe TraverserBounds` there. We don't
|
||||||
|
want to deal with unwrapping the `Maybe a` values every time we use the traverser,
|
||||||
|
especially if we've done so before. So, we define a `ValidTraverserData` record
|
||||||
|
that does not have `Maybe` arguments, and thus, has all the required data. At the
|
||||||
|
end of a traverser declaration, we attempt to translate a `TraverserData` into
|
||||||
|
a `ValidTraverserData`, invoking `fail` if we can't, and storing the `ValidTraverserData`
|
||||||
|
into the state otherwise:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageThree.hs" 408 420 >}}
|
||||||
|
|
||||||
|
Then, every time we retrieve a traverser from the state,
|
||||||
|
define a lookup monadic operation like this:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageThree.hs" 240 244 >}}
|
||||||
|
|
||||||
|
##### Compiling Macros
|
||||||
|
I didn't call them macros for no reason. Clearly, we don't want to generate
|
||||||
|
code that
|
||||||
|
{{< sidenote "right" "increment-note" "calls functions only to increment an index." >}}
|
||||||
|
In fact, there's no easy way to do this at all. Python's integers (if we choose to
|
||||||
|
represent our traversers using integers), are immutable. Furthermore, unlike C++,
|
||||||
|
where passing by reference allows a function to change its parameters "outside"
|
||||||
|
the call, Python offers no way to reassign a different value to a variable given
|
||||||
|
to a function.
|
||||||
|
<br><br>
|
||||||
|
For an example use of C++'s pass-by-reference mechanic, consider <code>std::swap</code>:
|
||||||
|
it's a function, but it modifies the two variables given to it. There's no
|
||||||
|
way to generically implement such a function in Python.
|
||||||
|
{{< /sidenote >}} We also can't allow arbitrary expressions to serve as traversers:
|
||||||
|
our translator keeps some context about which variables are traversers, what their
|
||||||
|
bounds are, and how they behave. Thus, __calls to traverser macros are very much macros__:
|
||||||
|
they operate on AST nodes, and __require__ that their first argument is a variable,
|
||||||
|
named like the traverser. We use the `requireTraverser` monadic operation
|
||||||
|
to get the traverser associated with the given variable name, and then perform
|
||||||
|
the operation as intended. The `at!(t)` operation is straightforward:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageThree.hs" 317 319 >}}
|
||||||
|
|
||||||
|
The `at!(t,i)` is less so, since it deals with the intricacies of accessing
|
||||||
|
the list at either a positive of negative offset, depending on the direction
|
||||||
|
of the traverser. We implement a function to properly generate an expression for the offset:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageThree.hs" 246 249 >}}
|
||||||
|
|
||||||
|
We then implement `at!(t,i)` as follows:
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageThree.hs" 320 323 >}}
|
||||||
|
|
||||||
|
The most complicated macro is `bisect!`. It must be able to step the traverser,
|
||||||
|
and also return a tuple of two lists that the bisection yields. We also
|
||||||
|
prefer that it didn't pollute the environment with extra variables. To
|
||||||
|
achieve this, we want `bisect!` to be a function call. We want this
|
||||||
|
function to implement the iteration and list construction.
|
||||||
|
|
||||||
|
`bisect!`, by definition, takes a lambda. This lambda, in our language, is declared
|
||||||
|
in the lexical scope in which `bisect!` is called. Thus, to guarantee correct translation,
|
||||||
|
we must do one of two things:
|
||||||
|
|
||||||
|
1. Translate 1-to-1, and create a lambda, passing it to a fixed `bisect` function declared
|
||||||
|
elsewhere.
|
||||||
|
2. Translate to a nested function declaration,
|
||||||
|
{{< sidenote "right" "inline-note" "inlining the lambda." >}}
|
||||||
|
Inlining, in this case, means replacing a call to a function with the function's body.
|
||||||
|
We do this to prevent the overhead of calling a function, which typically involves pushing
|
||||||
|
on a stack and other extraneous work. If our function is simple, like a simple
|
||||||
|
comparison, it doesn't make sense to spend the effort calling it.
|
||||||
|
{{< /sidenote >}}
|
||||||
|
|
||||||
|
Since I quite like the idea of inlining a lambda, let's settle for that. To do this,
|
||||||
|
we pull a fresh temporary variable and declare a function, into which we place
|
||||||
|
the traverser iteration code, as well as the body of the lambda, with the variable
|
||||||
|
substituted for the list access expression.
|
||||||
|
{{< sidenote "left" "nonlocal-note" "Here's the code:" >}}
|
||||||
|
Reading the lexical scope is one thing, but modifying it is another. To prevent
|
||||||
|
accidental changes to the variables outside a nested function, Python assumes
|
||||||
|
that variables assigned inside the function body are local to the function. Thus, to make
|
||||||
|
sure changing our variable (the traverser index) has an effect outside the function
|
||||||
|
(as it should) we must include the <code>nonlocal</code> keyword, telling
|
||||||
|
Python that we're not declaring a new, local variable, but mutating the old one.
|
||||||
|
{{< /sidenote >}}
|
||||||
|
|
||||||
|
{{< codelines "Haskell" "cs325-langs/src/LanguageThree.hs" 342 363 >}}
|
||||||
|
|
||||||
|
### The Output
|
||||||
|
Let's see what the compiler spits out:
|
||||||
|
|
||||||
|
```Python
|
||||||
|
from bisect import bisect
|
||||||
|
import random
|
||||||
|
def qselect(xs,k,c):
|
||||||
|
if xs==[]:
|
||||||
|
return 0
|
||||||
|
bisector = 0
|
||||||
|
pivot = random.randrange(len(xs))
|
||||||
|
pivotE = xs.pop(pivot)
|
||||||
|
def temp1():
|
||||||
|
nonlocal bisector
|
||||||
|
l = []
|
||||||
|
r = []
|
||||||
|
while bisector<len(xs):
|
||||||
|
if c(xs[bisector])<c(pivotE):
|
||||||
|
l.append(xs[bisector])
|
||||||
|
else:
|
||||||
|
r.append(xs[bisector])
|
||||||
|
bisector = bisector+1
|
||||||
|
return (l, r)
|
||||||
|
(leftList,rightList) = temp1()
|
||||||
|
if k>len(leftList)+1:
|
||||||
|
return qselect(rightList, k-len(leftList)-1, c)
|
||||||
|
elif k==len(leftList)+1:
|
||||||
|
return pivotE
|
||||||
|
else:
|
||||||
|
return qselect(leftList, k, c)
|
||||||
|
def closestUnsorted(xs,k,n):
|
||||||
|
min = qselect(list(xs), k, (lambda x: abs(x-n)))
|
||||||
|
out = []
|
||||||
|
countEqual = k
|
||||||
|
iter = 0
|
||||||
|
while iter<len(xs):
|
||||||
|
if abs(xs[iter]-n)<abs(min-n):
|
||||||
|
countEqual = countEqual-1
|
||||||
|
iter = iter+1
|
||||||
|
0
|
||||||
|
iter = 0
|
||||||
|
while iter<len(xs):
|
||||||
|
if abs(xs[iter]-n)==abs(min-n) and countEqual>0:
|
||||||
|
countEqual = countEqual-1
|
||||||
|
out = out+[xs[iter]]
|
||||||
|
elif abs(xs[iter]-n)<abs(min-n):
|
||||||
|
out = out+[xs[iter]]
|
||||||
|
iter = iter+1
|
||||||
|
0
|
||||||
|
return out
|
||||||
|
def closestSorted(xs,k,n):
|
||||||
|
start = bisect(xs, n)
|
||||||
|
counter = 0
|
||||||
|
left = start
|
||||||
|
right = start
|
||||||
|
while counter!=k and left-1*1>=0 and right<len(xs):
|
||||||
|
if abs(xs[left-1*1]-n)<abs(xs[right]-n):
|
||||||
|
left = left-1
|
||||||
|
0
|
||||||
|
else:
|
||||||
|
right = right+1
|
||||||
|
0
|
||||||
|
counter = counter+1
|
||||||
|
while counter!=k and (left-1*1>=0 or right<len(xs)):
|
||||||
|
if left-1*1>=0:
|
||||||
|
left = left-1
|
||||||
|
0
|
||||||
|
else:
|
||||||
|
right = right+1
|
||||||
|
0
|
||||||
|
counter = counter+1
|
||||||
|
return xs[(left):(right)]
|
||||||
|
def xyz(xs,k):
|
||||||
|
xs.sort()
|
||||||
|
x = 0
|
||||||
|
dest = []
|
||||||
|
while x<len(xs):
|
||||||
|
z = x+2
|
||||||
|
y = x+1
|
||||||
|
while y<z and z<len(xs):
|
||||||
|
if xs[x]+xs[y]==xs[z]:
|
||||||
|
dest = dest+[(xs[x], xs[y], xs[z])]
|
||||||
|
z = z+1
|
||||||
|
0
|
||||||
|
elif xs[x]+xs[y]>xs[z]:
|
||||||
|
z = z+1
|
||||||
|
0
|
||||||
|
else:
|
||||||
|
y = y+1
|
||||||
|
0
|
||||||
|
x = x+1
|
||||||
|
0
|
||||||
|
return dest
|
||||||
|
```
|
||||||
|
|
||||||
|
Observe that the generated code just uses indices, `+`, `-`, and various comparison operators.
|
||||||
|
Our traverser is an example of a __zero cost abstraction__, a feature that, conceptually,
|
||||||
|
operates at a higher level, making us no longer worry about adding, subtracting, and
|
||||||
|
comparing numbers, while, in the final output, not damaging the performance of safety
|
||||||
|
of the code. Also observe the various `0` standalone statements. This is an issue
|
||||||
|
with the translator: traverser macros may not always yield an expression, but
|
||||||
|
the type of `translateExpr` and `translateStmt` effectively requires one. Thus,
|
||||||
|
when a macro doesn't generate anything useful, we give it the placeholder expression `0`.
|
||||||
|
|
||||||
|
That concludes this third post in the series. I hope to see you in the next one!
|
||||||
65
content/blog/10_compiler_polymorphism.md
Normal file
65
content/blog/10_compiler_polymorphism.md
Normal file
@@ -0,0 +1,65 @@
|
|||||||
|
---
|
||||||
|
title: Compiling a Functional Language Using C++, Part 10 - Polymorphism
|
||||||
|
date: 2019-12-09T23:26:46-08:00
|
||||||
|
tags: ["C and C++", "Functional Languages", "Compilers"]
|
||||||
|
draft: true
|
||||||
|
---
|
||||||
|
|
||||||
|
Last time, we wrote some pretty interesting programs in our little language.
|
||||||
|
We successfully expressed arithmetic and recursion. But there's one thing
|
||||||
|
that we cannot express in our language without further changes: an `if` statement.
|
||||||
|
|
||||||
|
Suppose we didn't want to add a special `if/else` expression into our language.
|
||||||
|
Thanks to lazy evaluation, we can express it using a function:
|
||||||
|
|
||||||
|
```
|
||||||
|
defn if c t e = {
|
||||||
|
case c of {
|
||||||
|
True -> { t }
|
||||||
|
False -> { e }
|
||||||
|
}
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
But an issue still remains: so far, our compiler remains __monomorphic__. That
|
||||||
|
is, a particular function can only have one possible type for each one of its
|
||||||
|
arguments. With our current setup, something like this
|
||||||
|
{{< sidenote "right" "if-note" "would not work:" >}}
|
||||||
|
In a polymorphically typed language, the inner <code>if</code> would just evaluate to
|
||||||
|
<code>False</code>, and the whole expression to 3.
|
||||||
|
{{< /sidenote >}}
|
||||||
|
|
||||||
|
```
|
||||||
|
if (if True False True) 11 3
|
||||||
|
```
|
||||||
|
|
||||||
|
This is because, for this to work, both of the following would need to hold (borrowing
|
||||||
|
some of our notation from the [typechecking]({{< relref "03_compiler_typechecking.md" >}}) post):
|
||||||
|
|
||||||
|
$$
|
||||||
|
\\text{if} : \\text{Int} \\rightarrow \\text{Int}
|
||||||
|
$$
|
||||||
|
$$
|
||||||
|
\\text{if} : \\text{Bool} \\rightarrow \\text{Bool}
|
||||||
|
$$
|
||||||
|
|
||||||
|
But using our rules so far, such a thing is impossible, since there is no way for
|
||||||
|
\\(\text{Int}\\) to be unified with \\(\text{Bool}\\). We need a more powerful
|
||||||
|
set of rules to describe our program's types. One such set of rules is
|
||||||
|
the [Hindley-Milner type system](https://en.wikipedia.org/wiki/Hindley%E2%80%93Milner_type_system),
|
||||||
|
which we have previously alluded to. In fact, the rules we came up
|
||||||
|
with were already very close to Hindley-Milner, with the exception of two:
|
||||||
|
__generalization__ and __instantiation__. Instantiation first:
|
||||||
|
|
||||||
|
$$
|
||||||
|
\frac
|
||||||
|
{\\Gamma \\vdash e : \\sigma \\quad \\sigma' \\sqsubseteq \\sigma}
|
||||||
|
{\\Gamma \\vdash e : \\sigma'}
|
||||||
|
$$
|
||||||
|
|
||||||
|
Next, generalization:
|
||||||
|
$$
|
||||||
|
\frac
|
||||||
|
{\\Gamma \\vdash e : \\sigma \\quad \\alpha \\not \\in \\text{free}(\\Gamma)}
|
||||||
|
{\\Gamma \\vdash e : \\forall a . \\sigma}
|
||||||
|
$$
|
||||||
110
content/blog/haskell_language_server_again.md
Normal file
110
content/blog/haskell_language_server_again.md
Normal file
@@ -0,0 +1,110 @@
|
|||||||
|
---
|
||||||
|
title: Using GHC IDE for Haskell Error Checking and Autocompletion
|
||||||
|
date: 2020-01-06T17:07:25-08:00
|
||||||
|
tags: ["Haskell", "Language Server Protocol"]
|
||||||
|
---
|
||||||
|
|
||||||
|
Last year, when I took Oregon State University's CS 381 class, I ended up setting
|
||||||
|
up my editor with the Haskell IDE engine. This made it possible
|
||||||
|
to detect errors, view types, and have good autocompletion within the editor itself.
|
||||||
|
Recently, I've found that GHC IDE works better for my projects, so instead
|
||||||
|
of butchering the original article, I'll just quickly write an updated version here,
|
||||||
|
referencing the old one when necessary.
|
||||||
|
|
||||||
|
By the end of the article, your editor should be able to detect errors and
|
||||||
|
properly autocomplete Haskell code, somewhat like in the below screenshot:
|
||||||
|
|
||||||
|

|
||||||
|
|
||||||
|
### Downloading and Installing GHC IDE
|
||||||
|
GHC IDE is a Haskell-based program that uses the
|
||||||
|
{{< sidenote "right" "lsp-note" "language server protocol" >}}
|
||||||
|
You don't really need to know what the language server protocol (LSP) is
|
||||||
|
to use GHC IDE. If you are nonetheless interested, I wrote a little
|
||||||
|
bit about it <a href="{{< ref "/blog/haskell_language_server" >}}#prelude-language-server-protocol">in the previous iteration of this post.</a>
|
||||||
|
If you want more information, check out the <a href="https://microsoft.github.io/language-server-protocol/">official Microsoft page on LSP.</a>
|
||||||
|
{{< /sidenote >}} to communicate with any editor that supports it. Editors
|
||||||
|
with support the the LSP include Atom, Visual Studio Code, Emacs, and Vim. Thus,
|
||||||
|
You can get a good Haskell development environment without tying yourself to one
|
||||||
|
application or service.
|
||||||
|
|
||||||
|
We first want to download the GHC IDE. To do this, you need to have
|
||||||
|
[Git](https://git-scm.com/) installed. Once you have that, in your Git bash (on Windows)
|
||||||
|
or in your terminal (maxOS, Linux), type the command:
|
||||||
|
|
||||||
|
```
|
||||||
|
git clone https://github.com/digital-asset/ghcide.git
|
||||||
|
```
|
||||||
|
|
||||||
|
To install GHC IDE, you can use either `cabal` (which is typically the `cabal-install` package,
|
||||||
|
and is required normally for this class) or `stack` (a build tool). For `cabal`:
|
||||||
|
|
||||||
|
```
|
||||||
|
cabal install
|
||||||
|
```
|
||||||
|
|
||||||
|
And for `stack`:
|
||||||
|
|
||||||
|
```
|
||||||
|
stack install
|
||||||
|
```
|
||||||
|
|
||||||
|
This will create an executable in your `~/.local/bin` directory. By default, this
|
||||||
|
is not usable from other programs, such as Vim, so you should add this directory
|
||||||
|
to your path. On Linux and macOS, this is done by adding the following line
|
||||||
|
to your `.bashrc` file (or equivalent):
|
||||||
|
|
||||||
|
```
|
||||||
|
export PATH=$PATH:/home/<yourusername>/.local/bin
|
||||||
|
```
|
||||||
|
|
||||||
|
On Windows, this is done by
|
||||||
|
{{< sidenote "right" "path-note" "editing your PATH variable." >}}
|
||||||
|
If you need to know how to change your <code>PATH</code>, I wrote
|
||||||
|
about it briefly in the <a href="{{< ref "/blog/haskell_language_server" >}}
|
||||||
|
#installation-of-v0-5-0-0-windows-systems">previous iteration of this post.</a>
|
||||||
|
{{< /sidenote >}} I don't run Windows,
|
||||||
|
so I don't know where `cabal install` will place the executable, but I do know
|
||||||
|
where the executable will appear if you use `stack install` - in the directory
|
||||||
|
given by:
|
||||||
|
|
||||||
|
```
|
||||||
|
stack path --local-bin
|
||||||
|
```
|
||||||
|
|
||||||
|
Adding that to your path should be sufficient to use GHC IDE.
|
||||||
|
|
||||||
|
### Setting up Your Editor
|
||||||
|
This is where the paths diverge. I personally use (Neo)vim, but for the sake
|
||||||
|
of completeness, I'll go over installation for Atom and VSCode (I'm not including
|
||||||
|
Emacs because I know nothing about configuring Emacs).
|
||||||
|
|
||||||
|
#### Atom
|
||||||
|
There appears to be an Atom extension specifically for GHC IDE:
|
||||||
|
[ide-haskell-ghcide](https://atom.io/packages/ide-haskell-ghcide). It doesn't
|
||||||
|
have a lot of configuration options, and will certainly require GHC IDE to
|
||||||
|
be in your path. However, since both GHC IDE and the Haskell IDE engine
|
||||||
|
use the Language Server Protocol, the more mature [ide-haskell-hie](https://atom.io/packages/ide-haskell-hie) extension may work, as well. In fact, since `ide-haskell-ghcide` is so young,
|
||||||
|
I'd recommend trying `ide-haskell-hie` first, configuring the settings (found under
|
||||||
|
_Settings > Packages > (Search ide-haskell-hie) > Settings_)
|
||||||
|
to use the following full path:
|
||||||
|
|
||||||
|
```
|
||||||
|
<output of stack path --local-bin>/ghcide
|
||||||
|
```
|
||||||
|
|
||||||
|
#### VSCode
|
||||||
|
The team behind GHC IDE maintains an official VSCode extension found
|
||||||
|
[here](https://marketplace.visualstudio.com/items?itemName=DigitalAssetHoldingsLLC.ghcide).
|
||||||
|
Installing it, when you have GHC IDE also installed, should be sufficient to get
|
||||||
|
VSCode to autocomplete and error check.
|
||||||
|
|
||||||
|
#### (Neo)vim
|
||||||
|
My original recommendations for (neo)vim remain unchanged, with the exception
|
||||||
|
of using `ghcide` instead of `hie` in the `serverCommands` variable. You
|
||||||
|
can find the original instructions
|
||||||
|
[here](https://danilafe.com/blog/haskell_language_server/#neovim).
|
||||||
|
|
||||||
|
### Conclusion
|
||||||
|
I hope that using GHC IDE, you'll be able to have a significantly more pleasant
|
||||||
|
Haskell experience in CS 381. Enjoy!
|
||||||
@@ -10,7 +10,7 @@ I found that __sidenotes__ were a feature that I didn't even know I needed.
|
|||||||
A lot of my writing seems to use small parenthesized remarks (like this), which,
|
A lot of my writing seems to use small parenthesized remarks (like this), which,
|
||||||
although it doesn't break the flow in a grammatical sense, lengthens the
|
although it doesn't break the flow in a grammatical sense, lengthens the
|
||||||
sentence, and makes it harder to follow. Since I do my best to write content
|
sentence, and makes it harder to follow. Since I do my best to write content
|
||||||
to help explain stuff (like the [compiler series]({{ relref "00_compiler_intro.md" }})),
|
to help explain stuff (like the [compiler series]({{< relref "00_compiler_intro.md" >}})),
|
||||||
making sentences __more__ difficult to understand is a no-go.
|
making sentences __more__ difficult to understand is a no-go.
|
||||||
|
|
||||||
So, what do they look like?
|
So, what do they look like?
|
||||||
|
|||||||
@@ -1,7 +1,10 @@
|
|||||||
@import "style.scss";
|
@import "style.scss";
|
||||||
|
|
||||||
$sidenote-width: 350px;
|
$sidenote-accommodate-shrink: 10rem;
|
||||||
$sidenote-offset: 15px;
|
$sidenote-width: 30rem;
|
||||||
|
$sidenote-offset: 1.5rem;
|
||||||
|
$sidenote-padding: 1rem;
|
||||||
|
$sidenote-highlight-border-width: .2rem;
|
||||||
|
|
||||||
.sidenote {
|
.sidenote {
|
||||||
&:hover {
|
&:hover {
|
||||||
@@ -11,15 +14,16 @@ $sidenote-offset: 15px;
|
|||||||
}
|
}
|
||||||
|
|
||||||
.sidenote-content {
|
.sidenote-content {
|
||||||
border: 2px dashed;
|
border: $sidenote-highlight-border-width dashed;
|
||||||
padding: 9px;
|
padding: $sidenote-padding -
|
||||||
|
($sidenote-highlight-border-width - $standard-border-width);
|
||||||
border-color: $primary-color;
|
border-color: $primary-color;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
.sidenote-label {
|
.sidenote-label {
|
||||||
border-bottom: 2px solid $primary-color;
|
border-bottom: .2rem solid $primary-color;
|
||||||
}
|
}
|
||||||
|
|
||||||
.sidenote-checkbox {
|
.sidenote-checkbox {
|
||||||
@@ -30,7 +34,7 @@ $sidenote-offset: 15px;
|
|||||||
display: block;
|
display: block;
|
||||||
position: absolute;
|
position: absolute;
|
||||||
width: $sidenote-width;
|
width: $sidenote-width;
|
||||||
margin-top: -1.5em;
|
margin-top: -1.5rem;
|
||||||
|
|
||||||
&.sidenote-right {
|
&.sidenote-right {
|
||||||
right: 0;
|
right: 0;
|
||||||
@@ -42,29 +46,50 @@ $sidenote-offset: 15px;
|
|||||||
margin-left: -($sidenote-width + $sidenote-offset);
|
margin-left: -($sidenote-width + $sidenote-offset);
|
||||||
}
|
}
|
||||||
|
|
||||||
@media screen and
|
@include bordered-block;
|
||||||
(max-width: $container-width + 2 * ($sidenote-width + 2 * $sidenote-offset)) {
|
padding: $sidenote-padding;
|
||||||
|
box-sizing: border-box;
|
||||||
|
text-align: left;
|
||||||
|
}
|
||||||
|
|
||||||
|
@mixin hidden-sidenote {
|
||||||
position: static;
|
position: static;
|
||||||
margin-top: 10px;
|
margin-top: 1rem;
|
||||||
margin-bottom: 10px;
|
margin-bottom: 1rem;
|
||||||
width: 100%;
|
width: 100%;
|
||||||
display: none;
|
display: none;
|
||||||
|
|
||||||
.sidenote-checkbox:checked ~ & {
|
.sidenote-checkbox:checked ~ & {
|
||||||
display: block;
|
display: block;
|
||||||
}
|
}
|
||||||
|
|
||||||
&.sidenote-left {
|
|
||||||
margin-left: 0px;
|
|
||||||
}
|
}
|
||||||
|
|
||||||
&.sidenote-right {
|
@media screen and
|
||||||
margin-right: 0px;
|
(max-width: $container-width + 2 * ($sidenote-width + 2 * $sidenote-offset)) {
|
||||||
|
.sidenote-content.sidenote-left {
|
||||||
|
@include hidden-sidenote;
|
||||||
|
margin-left: 0rem;
|
||||||
|
}
|
||||||
|
|
||||||
|
.container {
|
||||||
|
position: relative;
|
||||||
|
left: -$sidenote-width/2
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@include bordered-block;
|
@media screen and
|
||||||
padding: 10px;
|
(max-width: $container-width + ($sidenote-width + 3 * $sidenote-offset)) {
|
||||||
box-sizing: border-box;
|
.post-content {
|
||||||
text-align: left;
|
max-width: 100%;
|
||||||
}
|
}
|
||||||
|
|
||||||
|
.sidenote-content.sidenote-right {
|
||||||
|
@include hidden-sidenote;
|
||||||
|
margin-right: 0rem;
|
||||||
|
}
|
||||||
|
|
||||||
|
.container {
|
||||||
|
position: initial;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -1,24 +1,28 @@
|
|||||||
$container-width: 800px;
|
$container-width: 45rem;
|
||||||
|
$standard-border-width: .075rem;
|
||||||
|
|
||||||
$primary-color: #36e281;
|
$primary-color: #36e281;
|
||||||
$primary-color-dark: darken($primary-color, 10%);
|
$primary-color-dark: darken($primary-color, 10%);
|
||||||
$code-color: #f0f0f0;
|
$code-color: #f0f0f0;
|
||||||
$code-color-dark: darken($code-color, 10%);
|
$code-color-dark: darken($code-color, 10%);
|
||||||
$border-color: #bfbfbf;
|
$border-color: #bfbfbf;
|
||||||
|
|
||||||
$font-heading: "Lora", serif;
|
$font-heading: "Lora", serif;
|
||||||
$font-body: "Raleway", serif;
|
$font-body: "Raleway", serif;
|
||||||
$font-code: "Inconsolata", monospace;
|
$font-code: "Inconsolata", monospace;
|
||||||
$standard-border: 1px solid $border-color;
|
|
||||||
|
$standard-border: $standard-border-width solid $border-color;
|
||||||
|
|
||||||
@mixin bordered-block {
|
@mixin bordered-block {
|
||||||
border: $standard-border;
|
border: $standard-border;
|
||||||
border-radius: 2px;
|
border-radius: .2rem;
|
||||||
}
|
}
|
||||||
|
|
||||||
body {
|
body {
|
||||||
font-family: $font-body;
|
font-family: $font-body;
|
||||||
font-size: 1.0em;
|
font-size: 1.0rem;
|
||||||
line-height: 1.5;
|
line-height: 1.5;
|
||||||
margin-bottom: 1em;
|
margin-bottom: 1rem;
|
||||||
text-align: justify;
|
text-align: justify;
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -27,8 +31,8 @@ main {
|
|||||||
}
|
}
|
||||||
|
|
||||||
h1, h2, h3, h4, h5, h6 {
|
h1, h2, h3, h4, h5, h6 {
|
||||||
margin-bottom: .1em;
|
margin-bottom: .1rem;
|
||||||
margin-top: .5em;
|
margin-top: .5rem;
|
||||||
font-family: $font-heading;
|
font-family: $font-heading;
|
||||||
font-weight: normal;
|
font-weight: normal;
|
||||||
text-align: left;
|
text-align: left;
|
||||||
@@ -49,7 +53,7 @@ code {
|
|||||||
|
|
||||||
pre code {
|
pre code {
|
||||||
display: block;
|
display: block;
|
||||||
padding: 0.5em;
|
padding: 0.5rem;
|
||||||
overflow-x: auto;
|
overflow-x: auto;
|
||||||
background-color: $code-color;
|
background-color: $code-color;
|
||||||
}
|
}
|
||||||
@@ -61,12 +65,12 @@ pre code {
|
|||||||
box-sizing: border-box;
|
box-sizing: border-box;
|
||||||
|
|
||||||
@media screen and (max-width: $container-width){
|
@media screen and (max-width: $container-width){
|
||||||
padding: 0em 1em 0em 1em;
|
padding: 0rem 1rem 0rem 1rem;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
.button, input[type="submit"] {
|
.button, input[type="submit"] {
|
||||||
padding: 0.5em;
|
padding: 0.5rem;
|
||||||
background-color: $primary-color;
|
background-color: $primary-color;
|
||||||
border: none;
|
border: none;
|
||||||
color: white;
|
color: white;
|
||||||
@@ -87,7 +91,7 @@ pre code {
|
|||||||
nav {
|
nav {
|
||||||
background-color: $primary-color;
|
background-color: $primary-color;
|
||||||
width: 100%;
|
width: 100%;
|
||||||
margin: 1em 0px 1em 0px;
|
margin: 1rem 0rem 1rem 0rem;
|
||||||
}
|
}
|
||||||
|
|
||||||
nav a {
|
nav a {
|
||||||
@@ -110,7 +114,7 @@ nav a {
|
|||||||
}
|
}
|
||||||
|
|
||||||
.post-content {
|
.post-content {
|
||||||
margin-top: .5em;
|
margin-top: .5rem;
|
||||||
}
|
}
|
||||||
|
|
||||||
h1 {
|
h1 {
|
||||||
|
|||||||
@@ -7,8 +7,10 @@
|
|||||||
<link rel="stylesheet" href="//cdnjs.cloudflare.com/ajax/libs/normalize/5.0.0/normalize.min.css">
|
<link rel="stylesheet" href="//cdnjs.cloudflare.com/ajax/libs/normalize/5.0.0/normalize.min.css">
|
||||||
{{ $style := resources.Get "scss/style.scss" | resources.ToCSS | resources.Minify }}
|
{{ $style := resources.Get "scss/style.scss" | resources.ToCSS | resources.Minify }}
|
||||||
{{ $sidenotes := resources.Get "scss/sidenotes.scss" | resources.ToCSS | resources.Minify }}
|
{{ $sidenotes := resources.Get "scss/sidenotes.scss" | resources.ToCSS | resources.Minify }}
|
||||||
|
{{ $icon := resources.Get "img/favicon.png" }}
|
||||||
<link rel="stylesheet" href="{{ $style.Permalink }}">
|
<link rel="stylesheet" href="{{ $style.Permalink }}">
|
||||||
<link rel="stylesheet" href="{{ $sidenotes.Permalink }}">
|
<link rel="stylesheet" href="{{ $sidenotes.Permalink }}">
|
||||||
|
<link rel="icon" type="image/png" href="{{ $icon.Permalink }}">
|
||||||
|
|
||||||
<script src='https://cdnjs.cloudflare.com/ajax/libs/mathjax/2.7.5/MathJax.js?config=TeX-MML-AM_CHTML' async></script>
|
<script src='https://cdnjs.cloudflare.com/ajax/libs/mathjax/2.7.5/MathJax.js?config=TeX-MML-AM_CHTML' async></script>
|
||||||
{{ template "_internal/google_analytics.html" . }}
|
{{ template "_internal/google_analytics.html" . }}
|
||||||
|
|||||||
9
themes/vanilla/layouts/shortcodes/numberedsidenote
Normal file
9
themes/vanilla/layouts/shortcodes/numberedsidenote
Normal file
@@ -0,0 +1,9 @@
|
|||||||
|
{{ .Page.Scratch.Add "numbernote-id" 1 }}
|
||||||
|
{{ $id := .Page.Scratch.Get "numbernote-id" }}
|
||||||
|
<span class="sidenote">
|
||||||
|
<label class="sidenote-label" for="numbernote-{{ $id }}">({{ $id }})</label>
|
||||||
|
<input class="sidenote-checkbox" type="checkbox" id="numbernote-{{ $id }}"></input>
|
||||||
|
<span class="sidenote-content sidenote-{{ .Get 0 }}">
|
||||||
|
{{ .Inner }}
|
||||||
|
</span>
|
||||||
|
</span>
|
||||||
Reference in New Issue
Block a user