Add missing backslashes

This reverts commit 133979218a.

.drone.yml

@@ -0,0 +1,38 @@
+kind: pipeline
+type: docker
+name: default
+
+volumes:
+  - name: live-output
+    temp: {}
+
+steps:
+  - name: test-compiler
+    image: archlinux
+    commands:
+    - pacman -Sy cmake gcc make llvm bison flex gettext --noconfirm
+    - cd code/compiler
+    - ./test.sh
+  - name: build-live
+    image: klakegg/hugo:ext-alpine
+    commands:
+    - hugo -D --baseUrl "http://danilafe.com:8080"
+    volumes:
+    - name: live-output
+      path: /live-output
+    environment:
+      HUGO_DESTINATION: /live-output
+  - name: upload-live
+    image: eeacms/rsync
+    commands:
+    - eval `ssh-agent -s`
+    - echo "$CUSTOM_KEY" | ssh-add -
+    - mkdir -p ~/.ssh
+    - echo -e "Host *\n\tStrictHostKeyChecking no\n\n" > ~/.ssh/config
+    - rsync -rv -e "ssh -p 22" /live-output/ blog-live@danilafe.com:/var/www/blog-live/ --checksum
+    environment:
+      CUSTOM_KEY:
+        from_secret: live_ssh_key
+    volumes:
+    - name: live-output
+      path: /live-output

assets/scss/gmachine.scss

@@ -1,4 +1,5 @@
-@import "style.scss";
+@import "variables.scss";
+@import "mixins.scss";
 
 .gmachine-instruction {
     display: flex;
@@ -6,7 +7,7 @@
 }
 
 .gmachine-instruction-name {
-    padding: 10px;
+    padding: .8rem;
     border-right: $standard-border;
     flex-grow: 1;
     flex-basis: 20%;
@@ -28,12 +29,12 @@
 }
 
 .gmachine-inner-label {
-    padding: 10px;
+    padding: .8rem;
     font-weight: bold;
 }
 
 .gmachine-inner-text {
-    padding: 10px;
+    padding: .8rem;
     text-align: right;
     flex-grow: 1;
 }

assets/scss/stack.scss

@@ -0,0 +1,19 @@
+@import "variables.scss";
+@import "mixins.scss";
+
+.stack {
+    display: flex;
+    flex-direction: column;
+    max-width: 10rem;
+    margin: auto;
+    @include bordered-block;
+}
+
+.stack-element {
+    text-align: center;
+    min-height: 1.5rem;
+
+    &:not(:last-child) {
+        border-bottom: $standard-border;
+    }
+}

code/compiler/08/examples/works1.txt

@@ -1,3 +1,2 @@
 defn main = { sum 320 6 }
 defn sum x y = { x + y }
-

code/compiler/09/CMakeLists.txt

@@ -0,0 +1,42 @@
+cmake_minimum_required(VERSION 3.1)
+project(compiler)
+
+# Find all the required packages
+find_package(BISON)
+find_package(FLEX)
+find_package(LLVM REQUIRED CONFIG)
+
+# Set up the flex and bison targets
+bison_target(parser
+    ${CMAKE_CURRENT_SOURCE_DIR}/parser.y
+    ${CMAKE_CURRENT_BINARY_DIR}/parser.cpp
+    COMPILE_FLAGS "-d")
+flex_target(scanner
+    ${CMAKE_CURRENT_SOURCE_DIR}/scanner.l
+    ${CMAKE_CURRENT_BINARY_DIR}/scanner.cpp)
+add_flex_bison_dependency(scanner parser)
+
+# Find all the relevant LLVM components
+llvm_map_components_to_libnames(LLVM_LIBS core x86asmparser x86codegen)
+
+# Create compiler executable
+add_executable(compiler
+    ast.cpp ast.hpp definition.cpp
+    llvm_context.cpp llvm_context.hpp
+    type_env.cpp type_env.hpp
+    env.cpp env.hpp
+    type.cpp type.hpp
+    error.cpp error.hpp
+    binop.cpp binop.hpp
+    instruction.cpp instruction.hpp
+    ${BISON_parser_OUTPUTS}
+    ${FLEX_scanner_OUTPUTS}
+    main.cpp
+)
+
+# Configure compiler executable
+target_include_directories(compiler PUBLIC ${CMAKE_CURRENT_SOURCE_DIR})
+target_include_directories(compiler PUBLIC ${CMAKE_CURRENT_BINARY_DIR})
+target_include_directories(compiler PUBLIC ${LLVM_INCLUDE_DIRS})
+target_compile_definitions(compiler PUBLIC ${LLVM_DEFINITIONS})
+target_link_libraries(compiler ${LLVM_LIBS})

code/compiler/09/ast.cpp

@@ -0,0 +1,264 @@
+#include "ast.hpp"
+#include <ostream>
+#include "binop.hpp"
+#include "error.hpp"
+
+static void print_indent(int n, std::ostream& to) {
+    while(n--) to << "  ";
+}
+
+type_ptr ast::typecheck_common(type_mgr& mgr, const type_env& env) {
+    node_type = typecheck(mgr, env);
+    return node_type;
+}
+
+void ast::resolve_common(const type_mgr& mgr) {
+    type_var* var;
+    type_ptr resolved_type = mgr.resolve(node_type, var);
+    if(var) throw type_error("ambiguously typed program");
+
+    resolve(mgr);
+    node_type = std::move(resolved_type);
+}
+
+void ast_int::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "INT: " << value << std::endl;
+}
+
+type_ptr ast_int::typecheck(type_mgr& mgr, const type_env& env) const {
+    return type_ptr(new type_base("Int"));
+}
+
+void ast_int::resolve(const type_mgr& mgr) const {
+    
+}
+
+void ast_int::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    into.push_back(instruction_ptr(new instruction_pushint(value)));
+}
+
+void ast_lid::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "LID: " << id << std::endl;
+}
+
+type_ptr ast_lid::typecheck(type_mgr& mgr, const type_env& env) const {
+    return env.lookup(id);
+}
+
+void ast_lid::resolve(const type_mgr& mgr) const {
+
+}
+
+void ast_lid::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    into.push_back(instruction_ptr(
+        env->has_variable(id) ?
+            (instruction*) new instruction_push(env->get_offset(id)) :
+            (instruction*) new instruction_pushglobal(id)));
+}
+
+void ast_uid::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "UID: " << id << std::endl;
+}
+
+type_ptr ast_uid::typecheck(type_mgr& mgr, const type_env& env) const {
+    return env.lookup(id);
+}
+
+void ast_uid::resolve(const type_mgr& mgr) const {
+
+}
+
+void ast_uid::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    into.push_back(instruction_ptr(new instruction_pushglobal(id)));
+}
+
+void ast_binop::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "BINOP: " << op_name(op) << std::endl;
+    left->print(indent + 1, to);
+    right->print(indent + 1, to);
+}
+
+type_ptr ast_binop::typecheck(type_mgr& mgr, const type_env& env) const {
+    type_ptr ltype = left->typecheck_common(mgr, env);
+    type_ptr rtype = right->typecheck_common(mgr, env);
+    type_ptr ftype = env.lookup(op_name(op));
+    if(!ftype) throw type_error(std::string("unknown binary operator ") + op_name(op));
+
+    type_ptr return_type = mgr.new_type();
+    type_ptr arrow_one = type_ptr(new type_arr(rtype, return_type));
+    type_ptr arrow_two = type_ptr(new type_arr(ltype, arrow_one));
+
+    mgr.unify(arrow_two, ftype);
+    return return_type;
+}
+
+void ast_binop::resolve(const type_mgr& mgr) const {
+    left->resolve_common(mgr);
+    right->resolve_common(mgr);
+}
+
+void ast_binop::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    right->compile(env, into);
+    left->compile(env_ptr(new env_offset(1, env)), into);
+
+    into.push_back(instruction_ptr(new instruction_pushglobal(op_action(op))));
+    into.push_back(instruction_ptr(new instruction_mkapp()));
+    into.push_back(instruction_ptr(new instruction_mkapp()));
+}
+
+void ast_app::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "APP:" << std::endl;
+    left->print(indent + 1, to);
+    right->print(indent + 1, to);
+}
+
+type_ptr ast_app::typecheck(type_mgr& mgr, const type_env& env) const {
+    type_ptr ltype = left->typecheck_common(mgr, env);
+    type_ptr rtype = right->typecheck_common(mgr, env);
+
+    type_ptr return_type = mgr.new_type();
+    type_ptr arrow = type_ptr(new type_arr(rtype, return_type));
+    mgr.unify(arrow, ltype);
+    return return_type;
+}
+
+void ast_app::resolve(const type_mgr& mgr) const {
+    left->resolve_common(mgr);
+    right->resolve_common(mgr);
+}
+
+void ast_app::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    right->compile(env, into);
+    left->compile(env_ptr(new env_offset(1, env)), into);
+    into.push_back(instruction_ptr(new instruction_mkapp()));
+}
+
+void ast_case::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "CASE: " << std::endl;
+    for(auto& branch : branches) {
+        print_indent(indent + 1, to);
+        branch->pat->print(to);
+        to << std::endl;
+        branch->expr->print(indent + 2, to);
+    }
+}
+
+type_ptr ast_case::typecheck(type_mgr& mgr, const type_env& env) const {
+    type_var* var;
+    type_ptr case_type = mgr.resolve(of->typecheck_common(mgr, env), var);
+    type_ptr branch_type = mgr.new_type();
+
+    for(auto& branch : branches) {
+        type_env new_env = env.scope();
+        branch->pat->match(case_type, mgr, new_env);
+        type_ptr curr_branch_type = branch->expr->typecheck_common(mgr, new_env);
+        mgr.unify(branch_type, curr_branch_type);
+    }
+
+    case_type = mgr.resolve(case_type, var);
+    if(!dynamic_cast<type_data*>(case_type.get())) {
+        throw type_error("attempting case analysis of non-data type");
+    }
+
+    return branch_type;
+}
+
+void ast_case::resolve(const type_mgr& mgr) const {
+    of->resolve_common(mgr);
+    for(auto& branch : branches) {
+        branch->expr->resolve_common(mgr);
+    }
+}
+
+void ast_case::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    type_data* type = dynamic_cast<type_data*>(of->node_type.get());
+
+    of->compile(env, into);
+    into.push_back(instruction_ptr(new instruction_eval()));
+
+    instruction_jump* jump_instruction = new instruction_jump();
+    into.push_back(instruction_ptr(jump_instruction));
+    for(auto& branch : branches) {
+        std::vector<instruction_ptr> branch_instructions;
+        pattern_var* vpat;
+        pattern_constr* cpat;
+
+        if((vpat = dynamic_cast<pattern_var*>(branch->pat.get()))) {
+            branch->expr->compile(env_ptr(new env_offset(1, env)), branch_instructions);
+
+            for(auto& constr_pair : type->constructors) {
+                if(jump_instruction->tag_mappings.find(constr_pair.second.tag) !=
+                        jump_instruction->tag_mappings.end())
+                    break;
+
+                jump_instruction->tag_mappings[constr_pair.second.tag] =
+                    jump_instruction->branches.size();
+            }
+            jump_instruction->branches.push_back(std::move(branch_instructions));
+        } else if((cpat = dynamic_cast<pattern_constr*>(branch->pat.get()))) {
+            env_ptr new_env = env;
+            for(auto it = cpat->params.rbegin(); it != cpat->params.rend(); it++) {
+                new_env = env_ptr(new env_var(*it, new_env));
+            }
+
+            branch_instructions.push_back(instruction_ptr(new instruction_split(
+                            cpat->params.size())));
+            branch->expr->compile(new_env, branch_instructions);
+            branch_instructions.push_back(instruction_ptr(new instruction_slide(
+                            cpat->params.size())));
+
+            int new_tag = type->constructors[cpat->constr].tag;
+            if(jump_instruction->tag_mappings.find(new_tag) !=
+                    jump_instruction->tag_mappings.end())
+                throw type_error("technically not a type error: duplicate pattern");
+
+            jump_instruction->tag_mappings[new_tag] =
+                jump_instruction->branches.size();
+            jump_instruction->branches.push_back(std::move(branch_instructions));
+        }
+    }
+
+    for(auto& constr_pair : type->constructors) {
+        if(jump_instruction->tag_mappings.find(constr_pair.second.tag) ==
+                jump_instruction->tag_mappings.end())
+            throw type_error("non-total pattern");
+    }
+}
+
+void pattern_var::print(std::ostream& to) const {
+    to << var;
+}
+
+void pattern_var::match(type_ptr t, type_mgr& mgr, type_env& env) const {
+    env.bind(var, t);
+}
+
+void pattern_constr::print(std::ostream& to) const {
+    to << constr;
+    for(auto& param : params) {
+        to << " " << param;
+    }
+}
+
+void pattern_constr::match(type_ptr t, type_mgr& mgr, type_env& env) const {
+    type_ptr constructor_type = env.lookup(constr);
+    if(!constructor_type) {
+        throw type_error(std::string("pattern using unknown constructor ") + constr);
+    }
+
+    for(int i = 0; i < params.size(); i++) {
+        type_arr* arr = dynamic_cast<type_arr*>(constructor_type.get());
+        if(!arr) throw type_error("too many parameters in constructor pattern");
+
+        env.bind(params[i], arr->left);
+        constructor_type = arr->right;
+    }
+
+    mgr.unify(t, constructor_type);
+}

code/compiler/09/ast.hpp

@@ -0,0 +1,141 @@
+#pragma once
+#include <memory>
+#include <vector>
+#include "type.hpp"
+#include "type_env.hpp"
+#include "binop.hpp"
+#include "instruction.hpp"
+#include "env.hpp"
+
+struct ast {
+    type_ptr node_type;
+
+    virtual ~ast() = default;
+
+    virtual void print(int indent, std::ostream& to) const = 0;
+    virtual type_ptr typecheck(type_mgr& mgr, const type_env& env) const = 0;
+    virtual void resolve(const type_mgr& mgr) const = 0;
+    virtual void compile(const env_ptr& env,
+        std::vector<instruction_ptr>& into) const = 0;
+
+    type_ptr typecheck_common(type_mgr& mgr, const type_env& env);
+    void resolve_common(const type_mgr& mgr);
+};
+
+using ast_ptr = std::unique_ptr<ast>;
+
+struct pattern {
+    virtual ~pattern() = default;
+
+    virtual void print(std::ostream& to) const = 0;
+    virtual void match(type_ptr t, type_mgr& mgr, type_env& env) const = 0;
+};
+
+using pattern_ptr = std::unique_ptr<pattern>;
+
+struct branch {
+    pattern_ptr pat;
+    ast_ptr expr;
+
+    branch(pattern_ptr p, ast_ptr a)
+        : pat(std::move(p)), expr(std::move(a)) {}
+};
+
+using branch_ptr = std::unique_ptr<branch>;
+
+struct ast_int : public ast {
+    int value;
+
+    explicit ast_int(int v)
+        : value(v) {}
+
+    void print(int indent, std::ostream& to) const;
+    type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
+    void resolve(const type_mgr& mgr) const;
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct ast_lid : public ast {
+    std::string id;
+
+    explicit ast_lid(std::string i)
+        : id(std::move(i)) {}
+
+    void print(int indent, std::ostream& to) const;
+    type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
+    void resolve(const type_mgr& mgr) const;
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct ast_uid : public ast {
+    std::string id;
+
+    explicit ast_uid(std::string i)
+        : id(std::move(i)) {}
+
+    void print(int indent, std::ostream& to) const;
+    type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
+    void resolve(const type_mgr& mgr) const;
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct ast_binop : public ast {
+    binop op;  
+    ast_ptr left;
+    ast_ptr right;
+
+    ast_binop(binop o, ast_ptr l, ast_ptr r)
+        : op(o), left(std::move(l)), right(std::move(r)) {}
+
+    void print(int indent, std::ostream& to) const;
+    type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
+    void resolve(const type_mgr& mgr) const;
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct ast_app : public ast {
+    ast_ptr left;
+    ast_ptr right;
+
+    ast_app(ast_ptr l, ast_ptr r)
+        : left(std::move(l)), right(std::move(r)) {}
+
+    void print(int indent, std::ostream& to) const;
+    type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
+    void resolve(const type_mgr& mgr) const;
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct ast_case : public ast {
+    ast_ptr of;
+    std::vector<branch_ptr> branches;
+
+    ast_case(ast_ptr o, std::vector<branch_ptr> b)
+        : of(std::move(o)), branches(std::move(b)) {}
+
+    void print(int indent, std::ostream& to) const;
+    type_ptr typecheck(type_mgr& mgr, const type_env& env) const;
+    void resolve(const type_mgr& mgr) const;
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct pattern_var : public pattern {
+    std::string var;
+
+    pattern_var(std::string v)
+        : var(std::move(v)) {}
+
+    void print(std::ostream &to) const;
+    void match(type_ptr t, type_mgr& mgr, type_env& env) const;
+};
+
+struct pattern_constr : public pattern {
+    std::string constr;
+    std::vector<std::string> params;
+
+    pattern_constr(std::string c, std::vector<std::string> p)
+        : constr(std::move(c)), params(std::move(p)) {}
+
+    void print(std::ostream &to) const;
+    void match(type_ptr t, type_mgr&, type_env& env) const;
+};

code/compiler/09/binop.cpp

@@ -0,0 +1,21 @@
+#include "binop.hpp"
+
+std::string op_name(binop op) {
+    switch(op) {
+        case PLUS: return "+";
+        case MINUS: return "-";
+        case TIMES: return "*";
+        case DIVIDE: return "/";
+    }
+    return "??";
+}
+
+std::string op_action(binop op) {
+    switch(op) {
+        case PLUS: return "plus";
+        case MINUS: return "minus";
+        case TIMES: return "times";
+        case DIVIDE: return "divide";
+    }
+    return "??";
+}

code/compiler/09/binop.hpp

@@ -0,0 +1,12 @@
+#pragma once
+#include <string>
+
+enum binop {
+    PLUS,
+    MINUS,
+    TIMES,
+    DIVIDE
+};
+
+std::string op_name(binop op);
+std::string op_action(binop op);

code/compiler/09/definition.cpp

@@ -0,0 +1,121 @@
+#include "definition.hpp"
+#include "error.hpp"
+#include "ast.hpp"
+#include "instruction.hpp"
+#include "llvm_context.hpp"
+#include <llvm/IR/DerivedTypes.h>
+#include <llvm/IR/Function.h>
+#include <llvm/IR/Type.h>
+
+void definition_defn::typecheck_first(type_mgr& mgr, type_env& env) {
+    return_type = mgr.new_type();
+    type_ptr full_type = return_type;
+
+    for(auto it = params.rbegin(); it != params.rend(); it++) {
+        type_ptr param_type = mgr.new_type();
+        full_type = type_ptr(new type_arr(param_type, full_type));
+        param_types.push_back(param_type);
+    }
+
+    env.bind(name, full_type);
+}
+
+void definition_defn::typecheck_second(type_mgr& mgr, const type_env& env) const {
+    type_env new_env = env.scope();
+    auto param_it = params.begin();
+    auto type_it = param_types.rbegin();
+
+    while(param_it != params.end() && type_it != param_types.rend()) {
+        new_env.bind(*param_it, *type_it);
+        param_it++;
+        type_it++;
+    }
+
+    type_ptr body_type = body->typecheck_common(mgr, new_env);
+    mgr.unify(return_type, body_type);
+}
+
+void definition_defn::resolve(const type_mgr& mgr) {
+    type_var* var;
+    body->resolve_common(mgr);
+
+    return_type = mgr.resolve(return_type, var);
+    if(var) throw type_error("ambiguously typed program");
+    for(auto& param_type : param_types) {
+        param_type = mgr.resolve(param_type, var);
+        if(var) throw type_error("ambiguously typed program");
+    }
+}
+
+void definition_defn::compile() {
+    env_ptr new_env = env_ptr(new env_offset(0, nullptr));
+    for(auto it = params.rbegin(); it != params.rend(); it++) {
+        new_env = env_ptr(new env_var(*it, new_env));
+    }
+    body->compile(new_env, instructions);
+    instructions.push_back(instruction_ptr(new instruction_update(params.size())));
+    instructions.push_back(instruction_ptr(new instruction_pop(params.size())));
+}
+void definition_defn::gen_llvm_first(llvm_context& ctx) {
+    generated_function = ctx.create_custom_function(name, params.size());
+}
+
+void definition_defn::gen_llvm_second(llvm_context& ctx) {
+    ctx.builder.SetInsertPoint(&generated_function->getEntryBlock());
+    for(auto& instruction : instructions) {
+        instruction->gen_llvm(ctx, generated_function);
+    }
+    ctx.builder.CreateRetVoid();
+}
+
+void definition_data::typecheck_first(type_mgr& mgr, type_env& env) {
+    type_data* this_type = new type_data(name);
+    type_ptr return_type = type_ptr(this_type);
+    int next_tag = 0;
+
+    for(auto& constructor : constructors) {
+        constructor->tag = next_tag;
+        this_type->constructors[constructor->name] = { next_tag++ };
+
+        type_ptr full_type = return_type;
+        for(auto it = constructor->types.rbegin(); it != constructor->types.rend(); it++) {
+            type_ptr type = type_ptr(new type_base(*it));
+            full_type = type_ptr(new type_arr(type, full_type));
+        }
+
+        env.bind(constructor->name, full_type);
+    }
+}
+
+void definition_data::typecheck_second(type_mgr& mgr, const type_env& env) const {
+    // Nothing
+}
+
+void definition_data::resolve(const type_mgr& mgr) {
+    // Nothing
+}
+
+void definition_data::compile() {
+
+}
+
+void definition_data::gen_llvm_first(llvm_context& ctx) {
+    for(auto& constructor : constructors) {
+        auto new_function =
+            ctx.create_custom_function(constructor->name, constructor->types.size());
+        std::vector<instruction_ptr> instructions;
+        instructions.push_back(instruction_ptr(
+                new instruction_pack(constructor->tag, constructor->types.size())
+        ));
+        instructions.push_back(instruction_ptr(new instruction_update(0)));
+        ctx.builder.SetInsertPoint(&new_function->getEntryBlock());
+        for (auto& instruction : instructions) {
+            instruction->gen_llvm(ctx, new_function);
+        }
+        ctx.builder.CreateRetVoid();
+    }
+}
+
+void definition_data::gen_llvm_second(llvm_context& ctx) {
+    // Nothing
+}

code/compiler/09/definition.hpp

@@ -0,0 +1,73 @@
+#pragma once
+#include <memory>
+#include <vector>
+#include "instruction.hpp"
+#include "llvm_context.hpp"
+#include "type_env.hpp"
+
+struct ast;
+using ast_ptr = std::unique_ptr<ast>;
+
+struct definition {
+    virtual ~definition() = default;
+    
+    virtual void typecheck_first(type_mgr& mgr, type_env& env) = 0;
+    virtual void typecheck_second(type_mgr& mgr, const type_env& env) const = 0;
+    virtual void resolve(const type_mgr& mgr) = 0;
+    virtual void compile() = 0;
+    virtual void gen_llvm_first(llvm_context& ctx) = 0;
+    virtual void gen_llvm_second(llvm_context& ctx) = 0;
+};
+
+using definition_ptr = std::unique_ptr<definition>;
+
+struct constructor {
+    std::string name;
+    std::vector<std::string> types;
+    int8_t tag;
+
+    constructor(std::string n, std::vector<std::string> ts)
+        : name(std::move(n)), types(std::move(ts)) {}
+};
+
+using constructor_ptr = std::unique_ptr<constructor>;
+
+struct definition_defn : public definition {
+    std::string name;
+    std::vector<std::string> params;
+    ast_ptr body;
+
+    type_ptr return_type;
+    std::vector<type_ptr> param_types;
+
+    std::vector<instruction_ptr> instructions;
+
+    llvm::Function* generated_function;
+
+    definition_defn(std::string n, std::vector<std::string> p, ast_ptr b)
+        : name(std::move(n)), params(std::move(p)), body(std::move(b)) {
+
+    }
+
+    void typecheck_first(type_mgr& mgr, type_env& env);
+    void typecheck_second(type_mgr& mgr, const type_env& env) const;
+    void resolve(const type_mgr& mgr);
+    void compile();
+    void gen_llvm_first(llvm_context& ctx);
+    void gen_llvm_second(llvm_context& ctx);
+};
+
+struct definition_data : public definition {
+    std::string name;
+    std::vector<constructor_ptr> constructors;
+
+    definition_data(std::string n, std::vector<constructor_ptr> cs)
+        : name(std::move(n)), constructors(std::move(cs)) {}
+
+    void typecheck_first(type_mgr& mgr, type_env& env);
+    void typecheck_second(type_mgr& mgr, const type_env& env) const;
+    void resolve(const type_mgr& mgr);
+    void compile();
+    void gen_llvm_first(llvm_context& ctx);
+    void gen_llvm_second(llvm_context& ctx);
+};

code/compiler/09/env.cpp

@@ -0,0 +1,23 @@
+#include "env.hpp"
+
+int env_var::get_offset(const std::string& name) const {
+    if(name == this->name) return 0;
+    if(parent) return parent->get_offset(name) + 1;
+    throw 0;
+}
+
+bool env_var::has_variable(const std::string& name) const {
+    if(name == this->name) return true;
+    if(parent) return parent->has_variable(name);
+    return false;
+}
+
+int env_offset::get_offset(const std::string& name) const {
+    if(parent) return parent->get_offset(name) + offset;
+    throw 0;
+}
+
+bool env_offset::has_variable(const std::string& name) const {
+    if(parent) return parent->has_variable(name);
+    return false;
+}

code/compiler/09/env.hpp

@@ -0,0 +1,34 @@
+#pragma once
+#include <memory>
+#include <string>
+
+struct env {
+    virtual ~env() = default;
+
+    virtual int get_offset(const std::string& name) const = 0;
+    virtual bool has_variable(const std::string& name) const = 0;
+};
+
+using env_ptr = std::shared_ptr<env>;
+
+struct env_var : public env {
+    std::string name;
+    env_ptr parent;
+
+    env_var(std::string& n, env_ptr p)
+        : name(std::move(n)), parent(std::move(p)) {}
+
+    int get_offset(const std::string& name) const;
+    bool has_variable(const std::string& name) const;
+};
+
+struct env_offset : public env {
+    int offset;
+    env_ptr parent;
+
+    env_offset(int o, env_ptr p)
+        : offset(o), parent(std::move(p)) {}
+
+    int get_offset(const std::string& name) const;
+    bool has_variable(const std::string& name) const;
+};

code/compiler/09/error.cpp

@@ -0,0 +1,5 @@
+#include "error.hpp"
+
+const char* type_error::what() const noexcept {
+    return "an error occured while checking the types of the program";
+}

code/compiler/09/error.hpp

@@ -0,0 +1,21 @@
+#pragma once
+#include <exception>
+#include "type.hpp"
+
+struct type_error : std::exception {
+    std::string description;
+
+    type_error(std::string d)
+        : description(std::move(d)) {}
+
+    const char* what() const noexcept override;
+};
+
+struct unification_error : public type_error {
+    type_ptr left;
+    type_ptr right;
+
+    unification_error(type_ptr l, type_ptr r)
+        : left(std::move(l)), right(std::move(r)), 
+            type_error("failed to unify types") {}
+};

code/compiler/09/examples/bad1.txt

@@ -0,0 +1,2 @@
+data Bool = { True, False }
+defn main = { 3 + True }

code/compiler/09/examples/bad2.txt

@@ -0,0 +1 @@
+defn main = { 1 2 3 4 5 }

code/compiler/09/examples/bad3.txt

@@ -0,0 +1,8 @@
+data List = { Nil, Cons Int List }
+
+defn head l = {
+    case l of {
+        Nil -> { 0 }
+        Cons x y z -> { x }
+    }
+}

code/compiler/09/examples/primes.txt

@@ -0,0 +1,129 @@
+data List = { Nil, Cons Nat List }
+data Bool = { True, False }
+data Nat = { O, S Nat }
+
+defn ifN c t e = {
+    case c of {
+        True -> { t }
+        False -> { e }
+    }
+}
+
+defn ifL c t e = {
+    case c of {
+        True -> { t }
+        False -> { e }
+    }
+}
+
+defn toInt n = {
+    case n of {
+        O -> { 0 }
+        S np -> { 1 + toInt np }
+    }
+}
+
+defn lte n m = {
+    case m of {
+        O -> {
+            case n of {
+                O -> { True }
+                S np -> { False }
+            }
+        }
+        S mp -> {
+            case n of {
+                O -> { True }
+                S np -> { lte np mp }
+            }
+        }
+    }
+}
+
+defn minus n m = {
+    case m of {
+        O -> { n }
+        S mp -> { 
+            case n of {
+                O -> { O }
+                S np -> {
+                    minus np mp
+                }
+            }
+        }
+    }
+}
+
+defn mod n m = {
+    ifN (lte m n) (mod (minus n m) m) n
+}
+
+defn notDivisibleBy n m = {
+    case (mod m n) of {
+        O -> { False }
+        S mp -> { True }
+    }
+}
+
+defn filter f l = {
+    case l of {
+        Nil -> { Nil }
+        Cons x xs -> { ifL (f x) (Cons x (filter f xs)) (filter f xs) }
+    }
+}
+
+defn map f l = {
+    case l of {
+        Nil -> { Nil }
+        Cons x xs -> { Cons (f x) (map f xs) }
+    }
+}
+
+defn nats = {
+    Cons (S (S O)) (map S nats)
+}
+
+defn primesRec l = {
+    case l of {
+        Nil -> { Nil }
+        Cons p xs -> { Cons p (primesRec (filter (notDivisibleBy p) xs)) }
+    }
+}
+
+defn primes = {
+    primesRec nats
+}
+
+defn take n l = {
+    case l of {
+        Nil -> { Nil }
+        Cons x xs -> {
+            case n of {
+                O -> { Nil }
+                S np -> { Cons x (take np xs) }
+            }
+        }
+    }
+}
+
+defn head l = {
+    case l of {
+        Nil -> { O }
+        Cons x xs -> { x }
+    }
+}
+
+defn reverseAcc a l = {
+    case l of {
+        Nil -> { a }
+        Cons x xs -> { reverseAcc (Cons x a) xs }
+    }
+}
+
+defn reverse l = {
+    reverseAcc Nil l
+}
+
+defn main = {
+    toInt (head (reverse (take ((S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S O))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) primes)))
+}

code/compiler/09/examples/runtime1.c

@@ -0,0 +1,31 @@
+#include "../runtime.h"
+
+void f_add(struct stack* s) {
+    struct node_num* left = (struct node_num*) eval(stack_peek(s, 0));
+    struct node_num* right = (struct node_num*) eval(stack_peek(s, 1));
+    stack_push(s, (struct node_base*) alloc_num(left->value + right->value));
+}
+
+void f_main(struct stack* s) {
+    // PushInt 320
+    stack_push(s, (struct node_base*) alloc_num(320));
+
+    // PushInt 6
+    stack_push(s, (struct node_base*) alloc_num(6));
+
+    // PushGlobal f_add (the function for +)
+    stack_push(s, (struct node_base*) alloc_global(f_add, 2));
+
+    struct node_base* left;
+    struct node_base* right;
+    
+    // MkApp
+    left = stack_pop(s);
+    right = stack_pop(s);
+    stack_push(s, (struct node_base*) alloc_app(left, right));
+    
+    // MkApp
+    left = stack_pop(s);
+    right = stack_pop(s);
+    stack_push(s, (struct node_base*) alloc_app(left, right));
+}

code/compiler/09/examples/works1.txt

@@ -0,0 +1,2 @@
+defn main = { sum 320 6 }
+defn sum x y = { x + y }

code/compiler/09/examples/works2.txt

@@ -0,0 +1,3 @@
+defn add x y = { x + y }
+defn double x = { add x x }
+defn main = { double 163 }

code/compiler/09/examples/works3.txt

@@ -0,0 +1,8 @@
+data List = { Nil, Cons Int List }
+defn length l = {
+    case l of {
+        Nil -> { 0 }
+        Cons x xs -> { 1 + length xs }
+    }
+}
+defn main = { length (Cons 1 (Cons 2 (Cons 3 Nil))) }

code/compiler/09/examples/works4.txt

@@ -0,0 +1,16 @@
+data List = { Nil, Cons Int List }
+
+defn add x y = { x + y }
+defn mul x y = { x * y }
+
+defn foldr f b l = {
+    case l of {
+        Nil -> { b }
+        Cons x xs -> { f x (foldr f b xs) }
+    }
+}
+
+defn main = {
+    foldr add 0 (Cons 1 (Cons 2 (Cons 3 (Cons 4 Nil)))) +
+    foldr mul 1 (Cons 1 (Cons 2 (Cons 3 (Cons 4 Nil))))
+}

code/compiler/09/examples/works5.txt

@@ -0,0 +1,17 @@
+data List = { Nil, Cons Int List }
+
+defn sumZip l m = {
+    case l of {
+        Nil -> { 0 }
+        Cons x xs -> {
+            case m of {
+                Nil -> { 0 }
+                Cons y ys -> { x + y + sumZip xs ys }
+            }
+        }
+    }
+}
+
+defn ones = { Cons 1 ones }
+
+defn main = { sumZip ones (Cons 1 (Cons 2 (Cons 3 Nil))) }

code/compiler/09/instruction.cpp

@@ -0,0 +1,177 @@
+#include "instruction.hpp"
+#include "llvm_context.hpp"
+#include <llvm/IR/BasicBlock.h>
+#include <llvm/IR/Function.h>
+
+using namespace llvm;
+
+static void print_indent(int n, std::ostream& to) {
+    while(n--) to << "  ";
+}
+
+void instruction_pushint::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "PushInt(" << value << ")" << std::endl;
+}
+
+void instruction_pushint::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_push(f, ctx.create_num(f, ctx.create_i32(value)));
+}
+
+void instruction_pushglobal::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "PushGlobal(" << name << ")" << std::endl;
+}
+
+void instruction_pushglobal::gen_llvm(llvm_context& ctx, Function* f) const {
+    auto& global_f = ctx.custom_functions.at("f_" + name);
+    auto arity = ctx.create_i32(global_f->arity);
+    ctx.create_push(f, ctx.create_global(f, global_f->function, arity));
+}
+
+void instruction_push::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Push(" << offset << ")" << std::endl;
+}
+
+void instruction_push::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_push(f, ctx.create_peek(f, ctx.create_size(offset)));
+}
+
+void instruction_pop::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Pop(" << count << ")" << std::endl;
+}
+
+void instruction_pop::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_popn(f, ctx.create_size(count));
+}
+
+void instruction_mkapp::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "MkApp()" << std::endl;
+}
+
+void instruction_mkapp::gen_llvm(llvm_context& ctx, Function* f) const {
+    auto left = ctx.create_pop(f);
+    auto right = ctx.create_pop(f);
+    ctx.create_push(f, ctx.create_app(f, left, right));
+}
+
+void instruction_update::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Update(" << offset << ")" << std::endl;
+}
+
+void instruction_update::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_update(f, ctx.create_size(offset));
+}
+
+void instruction_pack::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Pack(" << tag << ", " << size << ")" << std::endl;
+}
+
+void instruction_pack::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_pack(f, ctx.create_size(size), ctx.create_i8(tag));
+}
+
+void instruction_split::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Split()" << std::endl;
+}
+
+void instruction_split::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_split(f, ctx.create_size(size));
+}
+
+void instruction_jump::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Jump(" << std::endl;
+    for(auto& instruction_set : branches) {
+        for(auto& instruction : instruction_set) {
+            instruction->print(indent + 2, to);
+        }
+        to << std::endl;
+    }
+    print_indent(indent, to);
+    to << ")" << std::endl;
+}
+
+void instruction_jump::gen_llvm(llvm_context& ctx, Function* f) const {
+    auto top_node = ctx.create_peek(f, ctx.create_size(0));
+    auto tag = ctx.unwrap_data_tag(top_node);
+    auto safety_block = BasicBlock::Create(ctx.ctx, "safety", f);
+    auto switch_op = ctx.builder.CreateSwitch(tag, safety_block, tag_mappings.size());
+    std::vector<BasicBlock*> blocks;
+
+    for(auto& branch : branches) {
+        auto branch_block = BasicBlock::Create(ctx.ctx, "branch", f);
+        ctx.builder.SetInsertPoint(branch_block);
+        for(auto& instruction : branch) {
+            instruction->gen_llvm(ctx, f);
+        }
+        ctx.builder.CreateBr(safety_block);
+        blocks.push_back(branch_block);
+    }
+
+    for(auto& mapping : tag_mappings) {
+        switch_op->addCase(ctx.create_i8(mapping.first), blocks[mapping.second]);
+    }
+
+    ctx.builder.SetInsertPoint(safety_block);
+}
+
+void instruction_slide::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Slide(" << offset << ")" << std::endl;
+}
+
+void instruction_slide::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_slide(f, ctx.create_size(offset));
+}
+
+void instruction_binop::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "BinOp(" << op_action(op) << ")" << std::endl;
+}
+
+void instruction_binop::gen_llvm(llvm_context& ctx, Function* f) const {
+    auto left_int = ctx.unwrap_num(ctx.create_pop(f));
+    auto right_int = ctx.unwrap_num(ctx.create_pop(f));
+    llvm::Value* result;
+    switch(op) {
+        case PLUS: result = ctx.builder.CreateAdd(left_int, right_int); break;
+        case MINUS: result = ctx.builder.CreateSub(left_int, right_int); break;
+        case TIMES: result = ctx.builder.CreateMul(left_int, right_int); break;
+        case DIVIDE: result = ctx.builder.CreateSDiv(left_int, right_int); break;
+    }
+    ctx.create_push(f, ctx.create_num(f, result));
+}
+
+void instruction_eval::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Eval()" << std::endl;
+}
+
+void instruction_eval::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_unwind(f);
+}
+
+void instruction_alloc::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Alloc(" << amount << ")" << std::endl;
+}
+
+void instruction_alloc::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_alloc(f, ctx.create_size(amount));
+}
+
+void instruction_unwind::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Unwind()" << std::endl;
+}
+
+void instruction_unwind::gen_llvm(llvm_context& ctx, Function* f) const {
+    // Nothing
+}

code/compiler/09/instruction.hpp

@@ -0,0 +1,142 @@
+#pragma once
+#include <llvm/IR/Function.h>
+#include <string>
+#include <memory>
+#include <vector>
+#include <map>
+#include <ostream>
+#include "binop.hpp"
+#include "llvm_context.hpp"
+
+struct instruction {
+    virtual ~instruction() = default;
+
+    virtual void print(int indent, std::ostream& to) const = 0;
+    virtual void gen_llvm(llvm_context& ctx, llvm::Function* f) const = 0;
+};
+
+using instruction_ptr = std::unique_ptr<instruction>;
+
+struct instruction_pushint : public instruction {
+    int value;
+
+    instruction_pushint(int v)
+        : value(v) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_pushglobal : public instruction {
+    std::string name;
+
+    instruction_pushglobal(std::string n)
+        : name(std::move(n)) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_push : public instruction {
+    int offset;
+
+    instruction_push(int o)
+        : offset(o) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_pop : public instruction {
+    int count;
+
+    instruction_pop(int c)
+        : count(c) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_mkapp : public instruction {
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_update : public instruction {
+    int offset;
+
+    instruction_update(int o)
+        : offset(o) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_pack : public instruction {
+    int tag;
+    int size;
+
+    instruction_pack(int t, int s)
+        : tag(t), size(s) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_split : public instruction {
+    int size;
+
+    instruction_split(int s)
+        : size(s) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_jump : public instruction {
+    std::vector<std::vector<instruction_ptr>> branches;
+    std::map<int, int> tag_mappings;
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_slide : public instruction {
+    int offset;
+
+    instruction_slide(int o)
+        : offset(o) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_binop : public instruction {
+    binop op;
+
+    instruction_binop(binop o)
+        : op(o) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_eval : public instruction {
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_alloc : public instruction {
+    int amount;
+
+    instruction_alloc(int a)
+        : amount(a) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_unwind : public instruction {
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};

code/compiler/09/llvm_context.cpp

@@ -0,0 +1,278 @@
+#include "llvm_context.hpp"
+#include <llvm/IR/DerivedTypes.h>
+
+using namespace llvm;
+
+void llvm_context::create_types() {
+    stack_type = StructType::create(ctx, "stack");
+    gmachine_type = StructType::create(ctx, "gmachine");
+    stack_ptr_type = PointerType::getUnqual(stack_type);
+    gmachine_ptr_type = PointerType::getUnqual(gmachine_type);
+    tag_type = IntegerType::getInt8Ty(ctx);
+    struct_types["node_base"] = StructType::create(ctx, "node_base");
+    struct_types["node_app"] = StructType::create(ctx, "node_app");
+    struct_types["node_num"] = StructType::create(ctx, "node_num");
+    struct_types["node_global"] = StructType::create(ctx, "node_global");
+    struct_types["node_ind"] = StructType::create(ctx, "node_ind");
+    struct_types["node_data"] = StructType::create(ctx, "node_data");
+    node_ptr_type = PointerType::getUnqual(struct_types.at("node_base"));
+    function_type = FunctionType::get(Type::getVoidTy(ctx), { gmachine_ptr_type }, false);
+
+    gmachine_type->setBody(
+            stack_ptr_type,
+            node_ptr_type,
+            IntegerType::getInt64Ty(ctx),
+            IntegerType::getInt64Ty(ctx)
+    );
+    struct_types.at("node_base")->setBody(
+            IntegerType::getInt32Ty(ctx),
+            IntegerType::getInt8Ty(ctx),
+            node_ptr_type
+    );
+    struct_types.at("node_app")->setBody(
+            struct_types.at("node_base"),
+            node_ptr_type,
+            node_ptr_type
+    );
+    struct_types.at("node_num")->setBody(
+            struct_types.at("node_base"),
+            IntegerType::getInt32Ty(ctx)
+    );
+    struct_types.at("node_global")->setBody(
+            struct_types.at("node_base"),
+            FunctionType::get(Type::getVoidTy(ctx), { stack_ptr_type }, false)
+    );
+    struct_types.at("node_ind")->setBody(
+            struct_types.at("node_base"),
+            node_ptr_type
+    );
+    struct_types.at("node_data")->setBody(
+            struct_types.at("node_base"),
+            IntegerType::getInt8Ty(ctx),
+            PointerType::getUnqual(node_ptr_type)
+    );
+}
+
+void llvm_context::create_functions() {
+    auto void_type = Type::getVoidTy(ctx);
+    auto sizet_type = IntegerType::get(ctx, sizeof(size_t) * 8);
+    functions["stack_init"] = Function::Create(
+            FunctionType::get(void_type, { stack_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_init",
+            &module
+    );
+    functions["stack_free"] = Function::Create(
+            FunctionType::get(void_type, { stack_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_free",
+            &module
+    );
+    functions["stack_push"] = Function::Create(
+            FunctionType::get(void_type, { stack_ptr_type, node_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_push",
+            &module
+    );
+    functions["stack_pop"] = Function::Create(
+            FunctionType::get(node_ptr_type, { stack_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_pop",
+            &module
+    );
+    functions["stack_peek"] = Function::Create(
+            FunctionType::get(node_ptr_type, { stack_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_peek",
+            &module
+    );
+    functions["stack_popn"] = Function::Create(
+            FunctionType::get(void_type, { stack_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_popn",
+            &module
+    );
+    functions["gmachine_slide"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_slide",
+            &module
+    );
+    functions["gmachine_update"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_update",
+            &module
+    );
+    functions["gmachine_alloc"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_alloc",
+            &module
+    );
+    functions["gmachine_pack"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type, sizet_type, tag_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_pack",
+            &module
+    );
+    functions["gmachine_split"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_split",
+            &module
+    );
+    functions["gmachine_track"] = Function::Create(
+            FunctionType::get(node_ptr_type, { gmachine_ptr_type, node_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_track",
+            &module
+    );
+
+    auto int32_type = IntegerType::getInt32Ty(ctx);
+    functions["alloc_app"] = Function::Create(
+            FunctionType::get(node_ptr_type, { node_ptr_type, node_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "alloc_app",
+            &module
+    );
+    functions["alloc_num"] = Function::Create(
+            FunctionType::get(node_ptr_type, { int32_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "alloc_num",
+            &module
+    );
+    functions["alloc_global"] = Function::Create(
+            FunctionType::get(node_ptr_type, { function_type, int32_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "alloc_global",
+            &module
+    );
+    functions["alloc_ind"] = Function::Create(
+            FunctionType::get(node_ptr_type, { node_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "alloc_ind",
+            &module
+    );
+
+    functions["unwind"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "unwind",
+            &module
+    );
+}
+
+ConstantInt* llvm_context::create_i8(int8_t i) {
+    return ConstantInt::get(ctx, APInt(8, i));
+}
+ConstantInt* llvm_context::create_i32(int32_t i) {
+    return ConstantInt::get(ctx, APInt(32, i));
+}
+ConstantInt* llvm_context::create_size(size_t i) {
+    return ConstantInt::get(ctx, APInt(sizeof(size_t) * 8, i));
+}
+
+Value* llvm_context::create_pop(Function* f) {
+    auto pop_f = functions.at("stack_pop");
+    return builder.CreateCall(pop_f, { unwrap_gmachine_stack_ptr(f->arg_begin()) });
+}
+Value* llvm_context::create_peek(Function* f, Value* off) {
+    auto peek_f = functions.at("stack_peek");
+    return builder.CreateCall(peek_f, { unwrap_gmachine_stack_ptr(f->arg_begin()), off });
+}
+void llvm_context::create_push(Function* f, Value* v) {
+    auto push_f = functions.at("stack_push");
+    builder.CreateCall(push_f, { unwrap_gmachine_stack_ptr(f->arg_begin()), v });
+}
+void llvm_context::create_popn(Function* f, Value* off) {
+    auto popn_f = functions.at("stack_popn");
+    builder.CreateCall(popn_f, { unwrap_gmachine_stack_ptr(f->arg_begin()), off });
+}
+void llvm_context::create_update(Function* f, Value* off) {
+    auto update_f = functions.at("gmachine_update");
+    builder.CreateCall(update_f, { f->arg_begin(), off });
+}
+void llvm_context::create_pack(Function* f, Value* c, Value* t) {
+    auto pack_f = functions.at("gmachine_pack");
+    builder.CreateCall(pack_f, { f->arg_begin(), c, t });
+}
+void llvm_context::create_split(Function* f, Value* c) {
+    auto split_f = functions.at("gmachine_split");
+    builder.CreateCall(split_f, { f->arg_begin(), c });
+}
+void llvm_context::create_slide(Function* f, Value* off) {
+    auto slide_f = functions.at("gmachine_slide");
+    builder.CreateCall(slide_f, { f->arg_begin(), off });
+}
+void llvm_context::create_alloc(Function* f, Value* n) {
+    auto alloc_f = functions.at("gmachine_alloc");
+    builder.CreateCall(alloc_f, { f->arg_begin(), n });
+}
+Value* llvm_context::create_track(Function* f, Value* v) {
+    auto track_f = functions.at("gmachine_track");
+    return builder.CreateCall(track_f, { f->arg_begin(), v });
+}
+
+void llvm_context::create_unwind(Function* f) {
+    auto unwind_f = functions.at("unwind");
+    builder.CreateCall(unwind_f, { f->args().begin() });
+}
+
+Value* llvm_context::unwrap_gmachine_stack_ptr(Value* g) {
+    auto offset_0 = create_i32(0);
+    return builder.CreateGEP(g, { offset_0, offset_0 });
+}
+
+Value* llvm_context::unwrap_num(Value* v) {
+    auto num_ptr_type = PointerType::getUnqual(struct_types.at("node_num"));
+    auto cast = builder.CreatePointerCast(v, num_ptr_type);
+    auto offset_0 = create_i32(0);
+    auto offset_1 = create_i32(1);
+    auto int_ptr = builder.CreateGEP(cast, { offset_0, offset_1 });
+    return builder.CreateLoad(int_ptr);
+}
+Value* llvm_context::create_num(Function* f, Value* v) {
+    auto alloc_num_f = functions.at("alloc_num");
+    auto alloc_num_call = builder.CreateCall(alloc_num_f, { v });
+    return create_track(f, alloc_num_call);
+}
+
+Value* llvm_context::unwrap_data_tag(Value* v) {
+    auto data_ptr_type = PointerType::getUnqual(struct_types.at("node_data"));
+    auto cast = builder.CreatePointerCast(v, data_ptr_type);
+    auto offset_0 = create_i32(0);
+    auto offset_1 = create_i32(1);
+    auto tag_ptr = builder.CreateGEP(cast, { offset_0, offset_1 });
+    return builder.CreateLoad(tag_ptr);
+}
+
+Value* llvm_context::create_global(Function* f, Value* gf, Value* a) {
+    auto alloc_global_f = functions.at("alloc_global");
+    auto alloc_global_call = builder.CreateCall(alloc_global_f, { gf, a });
+    return create_track(f, alloc_global_call);
+}
+
+Value* llvm_context::create_app(Function* f, Value* l, Value* r) {
+    auto alloc_app_f = functions.at("alloc_app");
+    auto alloc_app_call = builder.CreateCall(alloc_app_f, { l, r });
+    return create_track(f, alloc_app_call);
+}
+
+llvm::Function* llvm_context::create_custom_function(std::string name, int32_t arity) {
+    auto void_type = llvm::Type::getVoidTy(ctx);
+    auto new_function = llvm::Function::Create(
+            function_type,
+            llvm::Function::LinkageTypes::ExternalLinkage,
+            "f_" + name,
+            &module
+    );
+    auto start_block = llvm::BasicBlock::Create(ctx, "entry", new_function);
+
+    auto new_custom_f = custom_function_ptr(new custom_function());
+    new_custom_f->arity = arity;
+    new_custom_f->function = new_function;
+    custom_functions["f_" + name] = std::move(new_custom_f);
+
+    return new_function;
+}

code/compiler/09/llvm_context.hpp

@@ -0,0 +1,72 @@
+#pragma once
+#include <llvm/IR/DerivedTypes.h>
+#include <llvm/IR/Function.h>
+#include <llvm/IR/LLVMContext.h>
+#include <llvm/IR/IRBuilder.h>
+#include <llvm/IR/Module.h>
+#include <llvm/IR/Value.h>
+#include <map>
+
+struct llvm_context {
+    struct custom_function {
+        llvm::Function* function;
+        int32_t arity;
+    };
+
+    using custom_function_ptr = std::unique_ptr<custom_function>;
+
+    llvm::LLVMContext ctx;
+    llvm::IRBuilder<> builder;
+    llvm::Module module;
+
+    std::map<std::string, custom_function_ptr> custom_functions;
+    std::map<std::string, llvm::Function*> functions;
+    std::map<std::string, llvm::StructType*> struct_types;
+
+    llvm::StructType* stack_type;
+    llvm::StructType* gmachine_type;
+    llvm::PointerType* stack_ptr_type;
+    llvm::PointerType* gmachine_ptr_type;
+    llvm::PointerType* node_ptr_type;
+    llvm::IntegerType* tag_type;
+    llvm::FunctionType* function_type;
+
+    llvm_context()
+        : builder(ctx), module("bloglang", ctx) {
+        create_types();
+        create_functions();
+    }
+
+    void create_types();
+    void create_functions();
+
+    llvm::ConstantInt* create_i8(int8_t);
+    llvm::ConstantInt* create_i32(int32_t);
+    llvm::ConstantInt* create_size(size_t);
+
+    llvm::Value* create_pop(llvm::Function*);
+    llvm::Value* create_peek(llvm::Function*, llvm::Value*);
+    void create_push(llvm::Function*, llvm::Value*);
+    void create_popn(llvm::Function*, llvm::Value*);
+    void create_update(llvm::Function*, llvm::Value*);
+    void create_pack(llvm::Function*, llvm::Value*, llvm::Value*);
+    void create_split(llvm::Function*, llvm::Value*);
+    void create_slide(llvm::Function*, llvm::Value*);
+    void create_alloc(llvm::Function*, llvm::Value*);
+    llvm::Value* create_track(llvm::Function*, llvm::Value*);
+
+    void create_unwind(llvm::Function*);
+
+    llvm::Value* unwrap_gmachine_stack_ptr(llvm::Value*);
+
+    llvm::Value* unwrap_num(llvm::Value*);
+    llvm::Value* create_num(llvm::Function*, llvm::Value*);
+
+    llvm::Value* unwrap_data_tag(llvm::Value*);
+
+    llvm::Value* create_global(llvm::Function*, llvm::Value*, llvm::Value*);
+
+    llvm::Value* create_app(llvm::Function*, llvm::Value*, llvm::Value*);
+
+    llvm::Function* create_custom_function(std::string name, int32_t arity);
+};

code/compiler/09/main.cpp

@@ -0,0 +1,176 @@
+#include "ast.hpp"
+#include <iostream>
+#include "binop.hpp"
+#include "definition.hpp"
+#include "instruction.hpp"
+#include "llvm_context.hpp"
+#include "parser.hpp"
+#include "error.hpp"
+#include "type.hpp"
+#include "llvm/IR/LegacyPassManager.h"
+#include "llvm/IR/Verifier.h"
+#include "llvm/Support/TargetSelect.h"
+#include "llvm/Support/TargetRegistry.h"
+#include "llvm/Support/raw_ostream.h"
+#include "llvm/Support/FileSystem.h"
+#include "llvm/Target/TargetOptions.h"
+#include "llvm/Target/TargetMachine.h"
+
+void yy::parser::error(const std::string& msg) {
+    std::cout << "An error occured: " << msg << std::endl;
+}
+
+extern std::vector<definition_ptr> program;
+
+void typecheck_program(
+        const std::vector<definition_ptr>& prog,
+        type_mgr& mgr, type_env& env) {
+    type_ptr int_type = type_ptr(new type_base("Int")); 
+    type_ptr binop_type = type_ptr(new type_arr(
+                int_type,
+                type_ptr(new type_arr(int_type, int_type))));
+
+    env.bind("+", binop_type);
+    env.bind("-", binop_type);
+    env.bind("*", binop_type);
+    env.bind("/", binop_type);
+
+    for(auto& def : prog) {
+        def->typecheck_first(mgr, env);
+    }
+
+    for(auto& def : prog) {
+        def->typecheck_second(mgr, env);
+    }
+
+    for(auto& pair : env.names) {
+        std::cout << pair.first << ": ";
+        pair.second->print(mgr, std::cout);
+        std::cout << std::endl;
+    }
+
+    for(auto& def : prog) {
+        def->resolve(mgr);
+    }
+}
+
+void compile_program(const std::vector<definition_ptr>& prog) {
+    for(auto& def : prog) {
+        def->compile();
+
+        definition_defn* defn = dynamic_cast<definition_defn*>(def.get());
+        if(!defn) continue;
+        for(auto& instruction : defn->instructions) {
+            instruction->print(0, std::cout);
+        }
+        std::cout << std::endl;
+    }
+}
+
+void gen_llvm_internal_op(llvm_context& ctx, binop op) {
+    auto new_function = ctx.create_custom_function(op_action(op), 2);
+    std::vector<instruction_ptr> instructions;
+    instructions.push_back(instruction_ptr(new instruction_push(1)));
+    instructions.push_back(instruction_ptr(new instruction_eval()));
+    instructions.push_back(instruction_ptr(new instruction_push(1)));
+    instructions.push_back(instruction_ptr(new instruction_eval()));
+    instructions.push_back(instruction_ptr(new instruction_binop(op)));
+    instructions.push_back(instruction_ptr(new instruction_update(2)));
+    instructions.push_back(instruction_ptr(new instruction_pop(2)));
+    ctx.builder.SetInsertPoint(&new_function->getEntryBlock());
+    for(auto& instruction : instructions) {
+        instruction->gen_llvm(ctx, new_function);
+    }
+    ctx.builder.CreateRetVoid();
+}
+
+void output_llvm(llvm_context& ctx, const std::string& filename) {
+    std::string targetTriple = llvm::sys::getDefaultTargetTriple();
+
+    llvm::InitializeNativeTarget();
+    llvm::InitializeNativeTargetAsmParser();
+    llvm::InitializeNativeTargetAsmPrinter();
+
+    std::string error;
+    const llvm::Target* target =
+        llvm::TargetRegistry::lookupTarget(targetTriple, error);
+    if (!target) {
+        std::cerr << error << std::endl;
+    } else {
+        std::string cpu = "generic";
+        std::string features = "";
+        llvm::TargetOptions options;
+        llvm::TargetMachine* targetMachine =
+            target->createTargetMachine(targetTriple, cpu, features,
+                    options, llvm::Optional<llvm::Reloc::Model>());
+
+        ctx.module.setDataLayout(targetMachine->createDataLayout());
+        ctx.module.setTargetTriple(targetTriple);
+
+        std::error_code ec;
+        llvm::raw_fd_ostream file(filename, ec, llvm::sys::fs::F_None);
+        if (ec) {
+            throw 0;
+        } else {
+            llvm::TargetMachine::CodeGenFileType type = llvm::TargetMachine::CGFT_ObjectFile;
+            llvm::legacy::PassManager pm;
+            if (targetMachine->addPassesToEmitFile(pm, file, NULL, type)) {
+                throw 0;
+            } else {
+                pm.run(ctx.module);
+                file.close();
+            }
+        }
+    }
+}
+
+void gen_llvm(const std::vector<definition_ptr>& prog) {
+    llvm_context ctx;
+    gen_llvm_internal_op(ctx, PLUS);
+    gen_llvm_internal_op(ctx, MINUS);
+    gen_llvm_internal_op(ctx, TIMES);
+    gen_llvm_internal_op(ctx, DIVIDE);
+
+    for(auto& definition : prog) {
+        definition->gen_llvm_first(ctx);
+    }
+
+    for(auto& definition : prog) {
+        definition->gen_llvm_second(ctx);
+    }
+    ctx.module.print(llvm::outs(), nullptr);
+    output_llvm(ctx, "program.o");
+}
+
+int main() {
+    yy::parser parser;
+    type_mgr mgr;
+    type_env env;
+
+    parser.parse();
+    for(auto& definition : program) {
+        definition_defn* def = dynamic_cast<definition_defn*>(definition.get());
+        if(!def) continue;
+
+        std::cout << def->name;
+        for(auto& param : def->params) std::cout << " " << param;
+        std::cout << ":" << std::endl;
+
+        def->body->print(1, std::cout);
+    }
+    try {
+        typecheck_program(program, mgr, env);
+        compile_program(program);
+        gen_llvm(program);
+    } catch(unification_error& err) {
+        std::cout << "failed to unify types: " << std::endl;
+        std::cout << "  (1) \033[34m";
+        err.left->print(mgr, std::cout);
+        std::cout << "\033[0m" << std::endl;
+        std::cout << "  (2) \033[32m";
+        err.right->print(mgr, std::cout);
+        std::cout << "\033[0m" << std::endl;
+    } catch(type_error& err) {
+        std::cout << "failed to type check program: " << err.description << std::endl;
+    }
+}

code/compiler/09/parser.y

@@ -0,0 +1,141 @@
+%{
+#include <string>
+#include <iostream>
+#include "ast.hpp"
+#include "definition.hpp"
+#include "parser.hpp"
+
+std::vector<definition_ptr> program;
+extern yy::parser::symbol_type yylex();
+
+%}
+
+%token PLUS
+%token TIMES
+%token MINUS
+%token DIVIDE
+%token <int> INT
+%token DEFN
+%token DATA
+%token CASE
+%token OF
+%token OCURLY
+%token CCURLY
+%token OPAREN
+%token CPAREN
+%token COMMA
+%token ARROW
+%token EQUAL
+%token <std::string> LID
+%token <std::string> UID
+
+%language "c++"
+%define api.value.type variant
+%define api.token.constructor
+
+%type <std::vector<std::string>> lowercaseParams uppercaseParams
+%type <std::vector<definition_ptr>> program definitions
+%type <std::vector<branch_ptr>> branches
+%type <std::vector<constructor_ptr>> constructors
+%type <ast_ptr> aAdd aMul case app appBase
+%type <definition_ptr> definition defn data 
+%type <branch_ptr> branch
+%type <pattern_ptr> pattern
+%type <constructor_ptr> constructor
+
+%start program
+
+%%
+
+program
+    : definitions { program = std::move($1); }
+    ;
+
+definitions
+    : definitions definition { $$ = std::move($1); $$.push_back(std::move($2)); }
+    | definition { $$ = std::vector<definition_ptr>(); $$.push_back(std::move($1)); }
+    ;
+
+definition
+    : defn { $$ = std::move($1); }
+    | data { $$ = std::move($1); }
+    ;
+
+defn
+    : DEFN LID lowercaseParams EQUAL OCURLY aAdd CCURLY
+        { $$ = definition_ptr(
+            new definition_defn(std::move($2), std::move($3), std::move($6))); }
+    ;
+
+lowercaseParams
+    : %empty { $$ = std::vector<std::string>(); }
+    | lowercaseParams LID { $$ = std::move($1); $$.push_back(std::move($2)); }
+    ;
+
+uppercaseParams
+    : %empty { $$ = std::vector<std::string>(); }
+    | uppercaseParams UID { $$ = std::move($1); $$.push_back(std::move($2)); }
+    ;
+
+aAdd
+    : aAdd PLUS aMul { $$ = ast_ptr(new ast_binop(PLUS, std::move($1), std::move($3))); }
+    | aAdd MINUS aMul { $$ = ast_ptr(new ast_binop(MINUS, std::move($1), std::move($3))); }
+    | aMul { $$ = std::move($1); }
+    ;
+
+aMul
+    : aMul TIMES app { $$ = ast_ptr(new ast_binop(TIMES, std::move($1), std::move($3))); }
+    | aMul DIVIDE app { $$ = ast_ptr(new ast_binop(DIVIDE, std::move($1), std::move($3))); }
+    | app { $$ = std::move($1); }
+    ;
+
+app
+    : app appBase { $$ = ast_ptr(new ast_app(std::move($1), std::move($2))); }
+    | appBase { $$ = std::move($1); }
+    ;
+
+appBase
+    : INT { $$ = ast_ptr(new ast_int($1)); }
+    | LID { $$ = ast_ptr(new ast_lid(std::move($1))); }
+    | UID { $$ = ast_ptr(new ast_uid(std::move($1))); }
+    | OPAREN aAdd CPAREN { $$ = std::move($2); }
+    | case { $$ = std::move($1); }
+    ;
+
+case
+    : CASE aAdd OF OCURLY branches CCURLY 
+        { $$ = ast_ptr(new ast_case(std::move($2), std::move($5))); }
+    ;
+
+branches
+    : branches branch { $$ = std::move($1); $$.push_back(std::move($2)); }
+    | branch { $$ = std::vector<branch_ptr>(); $$.push_back(std::move($1));}
+    ;
+
+branch
+    : pattern ARROW OCURLY aAdd CCURLY
+        { $$ = branch_ptr(new branch(std::move($1), std::move($4))); }
+    ;
+
+pattern
+    : LID { $$ = pattern_ptr(new pattern_var(std::move($1))); }
+    | UID lowercaseParams
+        { $$ = pattern_ptr(new pattern_constr(std::move($1), std::move($2))); }
+    ;
+
+data
+    : DATA UID EQUAL OCURLY constructors CCURLY
+        { $$ = definition_ptr(new definition_data(std::move($2), std::move($5))); }
+    ;
+
+constructors
+    : constructors COMMA constructor { $$ = std::move($1); $$.push_back(std::move($3)); }
+    | constructor
+        { $$ = std::vector<constructor_ptr>(); $$.push_back(std::move($1)); }
+    ;
+
+constructor
+    : UID uppercaseParams
+        { $$ = constructor_ptr(new constructor(std::move($1), std::move($2))); }
+    ;
+

code/compiler/09/runtime.c

@@ -0,0 +1,269 @@
+#include <stdint.h>
+#include <assert.h>
+#include <memory.h>
+#include <stdio.h>
+#include "runtime.h"
+
+struct node_base* alloc_node() {
+    struct node_base* new_node = malloc(sizeof(struct node_app));
+    new_node->gc_next = NULL;
+    new_node->gc_reachable = 0;
+    assert(new_node != NULL);
+    return new_node;
+}
+
+struct node_app* alloc_app(struct node_base* l, struct node_base* r) {
+    struct node_app* node = (struct node_app*) alloc_node();
+    node->base.tag = NODE_APP;
+    node->left = l;
+    node->right = r;
+    return node;
+}
+
+struct node_num* alloc_num(int32_t n) {
+    struct node_num* node = (struct node_num*) alloc_node();
+    node->base.tag = NODE_NUM;
+    node->value = n;
+    return node;
+}
+
+struct node_global* alloc_global(void (*f)(struct gmachine*), int32_t a) {
+    struct node_global* node = (struct node_global*) alloc_node();
+    node->base.tag = NODE_GLOBAL;
+    node->arity = a;
+    node->function = f;
+    return node;
+}
+
+struct node_ind* alloc_ind(struct node_base* n) {
+    struct node_ind* node = (struct node_ind*) alloc_node();
+    node->base.tag = NODE_IND;
+    node->next = n;
+    return node;
+}
+
+void free_node_direct(struct node_base* n) {
+    if(n->tag == NODE_DATA) {
+        free(((struct node_data*) n)->array);
+    }
+}
+
+void gc_visit_node(struct node_base* n) {
+    if(n->gc_reachable) return;
+    n->gc_reachable = 1;
+
+    if(n->tag == NODE_APP) {
+        struct node_app* app = (struct node_app*) n;
+        gc_visit_node(app->left);
+        gc_visit_node(app->right);
+    } if(n->tag == NODE_IND) {
+        struct node_ind* ind = (struct node_ind*) n;
+        gc_visit_node(ind->next);
+    } if(n->tag == NODE_DATA) {
+        struct node_data* data = (struct node_data*) n;
+        struct node_base** to_visit = data->array;
+        while(*to_visit) {
+            gc_visit_node(*to_visit);
+            to_visit++;
+        }
+    }
+}
+
+void stack_init(struct stack* s) {
+    s->size = 4;
+    s->count = 0;
+    s->data = malloc(sizeof(*s->data) * s->size);
+    assert(s->data != NULL);
+}
+
+void stack_free(struct stack* s) {
+    free(s->data);
+}
+
+void stack_push(struct stack* s, struct node_base* n) {
+    while(s->count >= s->size) {
+        s->data = realloc(s->data, sizeof(*s->data) * (s->size *= 2));
+        assert(s->data != NULL);
+    }
+    s->data[s->count++] = n;
+}
+
+struct node_base* stack_pop(struct stack* s) {
+    assert(s->count > 0);
+    return s->data[--s->count];
+}
+
+struct node_base* stack_peek(struct stack* s, size_t o) {
+    assert(s->count > o);
+    return s->data[s->count - o - 1];
+}
+
+void stack_popn(struct stack* s, size_t n) {
+    assert(s->count >= n);
+    s->count -= n;
+}
+
+void gmachine_init(struct gmachine* g) {
+    stack_init(&g->stack);
+    g->gc_nodes = NULL;
+    g->gc_node_count = 0;
+    g->gc_node_threshold = 128;
+}
+
+void gmachine_free(struct gmachine* g) {
+    stack_free(&g->stack);
+    struct node_base* to_free = g->gc_nodes;
+    struct node_base* next;
+
+    while(to_free) {
+        next = to_free->gc_next;
+        free_node_direct(to_free);
+        free(to_free);
+        to_free = next;
+    }
+}
+
+void gmachine_slide(struct gmachine* g, size_t n) {
+    assert(g->stack.count > n);
+    g->stack.data[g->stack.count - n - 1] = g->stack.data[g->stack.count - 1];
+    g->stack.count -= n;
+}
+
+void gmachine_update(struct gmachine* g, size_t o) {
+    assert(g->stack.count > o + 1);
+    struct node_ind* ind =
+        (struct node_ind*) g->stack.data[g->stack.count - o - 2];
+    ind->base.tag = NODE_IND;
+    ind->next = g->stack.data[g->stack.count -= 1];
+}
+
+void gmachine_alloc(struct gmachine* g, size_t o) {
+    while(o--) {
+        stack_push(&g->stack,
+                gmachine_track(g, (struct node_base*) alloc_ind(NULL)));
+    }
+}
+
+void gmachine_pack(struct gmachine* g, size_t n, int8_t t) {
+    assert(g->stack.count >= n);
+
+    struct node_base** data = malloc(sizeof(*data) * (n + 1));
+    assert(data != NULL);
+    memcpy(data, &g->stack.data[g->stack.count - n], n * sizeof(*data));
+    data[n] = NULL;
+
+    struct node_data* new_node = (struct node_data*) alloc_node();
+    new_node->array = data;
+    new_node->base.tag = NODE_DATA;
+    new_node->tag = t;
+
+    stack_popn(&g->stack, n);
+    stack_push(&g->stack, gmachine_track(g, (struct node_base*) new_node));
+}
+
+void gmachine_split(struct gmachine* g, size_t n) {
+    struct node_data* node = (struct node_data*) stack_pop(&g->stack);
+    for(size_t i = 0; i < n; i++) {
+        stack_push(&g->stack, node->array[i]);
+    }
+}
+
+struct node_base* gmachine_track(struct gmachine* g, struct node_base* b) {
+    g->gc_node_count++;
+    b->gc_next = g->gc_nodes;
+    g->gc_nodes = b;
+
+    if(g->gc_node_count >= g->gc_node_threshold) {
+        uint64_t nodes_before = g->gc_node_count;
+        gc_visit_node(b);
+        gmachine_gc(g);
+        g->gc_node_threshold = g->gc_node_count * 2;
+    }
+
+    return b;
+}
+
+void gmachine_gc(struct gmachine* g) {
+    for(size_t i = 0; i < g->stack.count; i++) {
+        gc_visit_node(g->stack.data[i]);
+    }
+
+    struct node_base** head_ptr = &g->gc_nodes;
+    while(*head_ptr) {
+        if((*head_ptr)->gc_reachable) {
+            (*head_ptr)->gc_reachable = 0;
+            head_ptr = &(*head_ptr)->gc_next;
+        } else {
+            struct node_base* to_free = *head_ptr;
+            *head_ptr = to_free->gc_next;
+            free_node_direct(to_free);
+            free(to_free);
+            g->gc_node_count--;
+        }
+    }
+}
+
+void unwind(struct gmachine* g) {
+    struct stack* s = &g->stack;
+
+    while(1) {
+        struct node_base* peek = stack_peek(s, 0);
+        if(peek->tag == NODE_APP) {
+            struct node_app* n = (struct node_app*) peek;
+            stack_push(s, n->left);
+        } else if(peek->tag == NODE_GLOBAL) {
+            struct node_global* n = (struct node_global*) peek;
+            assert(s->count > n->arity);
+
+            for(size_t i = 1; i <= n->arity; i++) {
+                s->data[s->count - i]
+                    = ((struct node_app*) s->data[s->count - i - 1])->right;
+            }
+
+            n->function(g);
+        } else if(peek->tag == NODE_IND) {
+            struct node_ind* n = (struct node_ind*) peek;
+            stack_pop(s);
+            stack_push(s, n->next);
+        } else {
+            break;
+        }
+    }
+}
+
+extern void f_main(struct gmachine* s);
+
+void print_node(struct node_base* n) {
+    if(n->tag == NODE_APP) {
+        struct node_app* app = (struct node_app*) n;
+        print_node(app->left);
+        putchar(' ');
+        print_node(app->right);
+    } else if(n->tag == NODE_DATA) {
+        printf("(Packed)");
+    } else if(n->tag == NODE_GLOBAL) {
+        struct node_global* global = (struct node_global*) n;
+        printf("(Global: %p)", global->function);
+    } else if(n->tag == NODE_IND) {
+        print_node(((struct node_ind*) n)->next);
+    } else if(n->tag == NODE_NUM) {
+        struct node_num* num = (struct node_num*) n;
+        printf("%d", num->value);
+    }
+}
+
+int main(int argc, char** argv) {
+    struct gmachine gmachine;
+    struct node_global* first_node = alloc_global(f_main, 0);
+    struct node_base* result;
+
+    gmachine_init(&gmachine);
+    gmachine_track(&gmachine, (struct node_base*) first_node);
+    stack_push(&gmachine.stack, (struct node_base*) first_node);
+    unwind(&gmachine);
+    result = stack_pop(&gmachine.stack);
+    printf("Result: ");
+    print_node(result);
+    putchar('\n');
+    gmachine_free(&gmachine);
+}

code/compiler/09/runtime.h

@@ -0,0 +1,84 @@
+#pragma once
+#include <stdlib.h>
+
+struct gmachine;
+
+enum node_tag {
+    NODE_APP,
+    NODE_NUM,
+    NODE_GLOBAL,
+    NODE_IND,
+    NODE_DATA
+};
+
+struct node_base {
+    enum node_tag tag;
+    int8_t gc_reachable;
+    struct node_base* gc_next;
+};
+
+struct node_app {
+    struct node_base base;
+    struct node_base* left;
+    struct node_base* right;
+};
+
+struct node_num {
+    struct node_base base;
+    int32_t value;
+};
+
+struct node_global {
+    struct node_base base;
+    int32_t arity;
+    void (*function)(struct gmachine*);
+};
+
+struct node_ind {
+    struct node_base base;
+    struct node_base* next;
+};
+
+struct node_data {
+    struct node_base base;
+    int8_t tag;
+    struct node_base** array;
+};
+
+struct node_base* alloc_node();
+struct node_app* alloc_app(struct node_base* l, struct node_base* r);
+struct node_num* alloc_num(int32_t n);
+struct node_global* alloc_global(void (*f)(struct gmachine*), int32_t a);
+struct node_ind* alloc_ind(struct node_base* n);
+void free_node_direct(struct node_base*);
+void gc_visit_node(struct node_base*);
+
+struct stack {
+    size_t size;
+    size_t count;
+    struct node_base** data;
+};
+
+void stack_init(struct stack* s);
+void stack_free(struct stack* s);
+void stack_push(struct stack* s, struct node_base* n);
+struct node_base* stack_pop(struct stack* s);
+struct node_base* stack_peek(struct stack* s, size_t o);
+void stack_popn(struct stack* s, size_t n);
+
+struct gmachine {
+    struct stack stack;
+    struct node_base* gc_nodes;
+    int64_t gc_node_count;
+    int64_t gc_node_threshold;
+};
+
+void gmachine_init(struct gmachine* g);
+void gmachine_free(struct gmachine* g);
+void gmachine_slide(struct gmachine* g, size_t n);
+void gmachine_update(struct gmachine* g, size_t o);
+void gmachine_alloc(struct gmachine* g, size_t o);
+void gmachine_pack(struct gmachine* g, size_t n, int8_t t);
+void gmachine_split(struct gmachine* g, size_t n);
+struct node_base* gmachine_track(struct gmachine* g, struct node_base* b);
+void gmachine_gc(struct gmachine* g);

code/compiler/09/scanner.l

@@ -0,0 +1,35 @@
+%option noyywrap
+
+%{
+#include <iostream>
+#include "ast.hpp"
+#include "definition.hpp"
+#include "parser.hpp"
+
+#define YY_DECL yy::parser::symbol_type yylex()
+
+%}
+
+%%
+
+[ \n]+ {}
+\+ { return yy::parser::make_PLUS(); }
+\* { return yy::parser::make_TIMES(); }
+- { return yy::parser::make_MINUS(); }
+\/ { return yy::parser::make_DIVIDE(); }
+[0-9]+ { return yy::parser::make_INT(atoi(yytext)); }
+defn { return yy::parser::make_DEFN(); }
+data { return yy::parser::make_DATA(); }
+case { return yy::parser::make_CASE(); }
+of { return yy::parser::make_OF(); }
+\{ { return yy::parser::make_OCURLY(); }
+\} { return yy::parser::make_CCURLY(); }
+\( { return yy::parser::make_OPAREN(); }
+\) { return yy::parser::make_CPAREN(); }
+,  { return yy::parser::make_COMMA(); }
+-> { return yy::parser::make_ARROW(); }
+= { return yy::parser::make_EQUAL(); }
+[a-z][a-zA-Z]* { return yy::parser::make_LID(std::string(yytext)); }
+[A-Z][a-zA-Z]* { return yy::parser::make_UID(std::string(yytext)); }
+
+%%

code/compiler/09/type.cpp

@@ -0,0 +1,99 @@
+#include "type.hpp"
+#include <sstream>
+#include <algorithm>
+#include "error.hpp"
+
+void type_var::print(const type_mgr& mgr, std::ostream& to) const {
+    auto it = mgr.types.find(name);
+    if(it != mgr.types.end()) {
+        it->second->print(mgr, to);
+    } else {
+        to << name;
+    }
+}
+
+void type_base::print(const type_mgr& mgr, std::ostream& to) const {
+    to << name;
+}
+
+void type_arr::print(const type_mgr& mgr, std::ostream& to) const {
+    left->print(mgr, to);
+    to << " -> (";
+    right->print(mgr, to);
+    to << ")";
+}
+
+std::string type_mgr::new_type_name() {
+    int temp = last_id++;
+    std::string str = "";
+
+    while(temp != -1) {
+        str += (char) ('a' + (temp % 26));
+        temp = temp / 26 - 1;
+    }
+
+    std::reverse(str.begin(), str.end());
+    return str;
+}
+
+type_ptr type_mgr::new_type() {
+    return type_ptr(new type_var(new_type_name()));
+}
+
+type_ptr type_mgr::new_arrow_type() {
+    return type_ptr(new type_arr(new_type(), new_type()));
+}
+
+type_ptr type_mgr::resolve(type_ptr t, type_var*& var) const {
+    type_var* cast;
+
+    var = nullptr;
+    while((cast = dynamic_cast<type_var*>(t.get()))) {
+        auto it = types.find(cast->name);
+
+        if(it == types.end()) {
+            var = cast;
+            break;
+        }
+        t = it->second;
+    }
+
+    return t;
+}
+
+void type_mgr::unify(type_ptr l, type_ptr r) {
+    type_var* lvar;
+    type_var* rvar;
+    type_arr* larr;
+    type_arr* rarr;
+    type_base* lid;
+    type_base* rid;
+
+    l = resolve(l, lvar);
+    r = resolve(r, rvar);
+
+    if(lvar) {
+        bind(lvar->name, r);
+        return;
+    } else if(rvar) {
+        bind(rvar->name, l);
+        return;
+    } else if((larr = dynamic_cast<type_arr*>(l.get())) &&
+            (rarr = dynamic_cast<type_arr*>(r.get()))) {
+        unify(larr->left, rarr->left);
+        unify(larr->right, rarr->right);
+        return;
+    } else if((lid = dynamic_cast<type_base*>(l.get())) &&
+            (rid = dynamic_cast<type_base*>(r.get()))) {
+        if(lid->name == rid->name) return;
+    }
+
+    throw unification_error(l, r);
+}
+
+void type_mgr::bind(const std::string& s, type_ptr t) {
+    type_var* other = dynamic_cast<type_var*>(t.get());
+    
+    if(other && other->name == s) return;
+    types[s] = t;
+}

code/compiler/09/type.hpp

@@ -0,0 +1,65 @@
+#pragma once
+#include <memory>
+#include <map>
+
+struct type_mgr;
+
+struct type {
+    virtual ~type() = default;
+
+    virtual void print(const type_mgr& mgr, std::ostream& to) const = 0;
+};
+
+using type_ptr = std::shared_ptr<type>;
+
+struct type_var : public type {
+    std::string name;
+
+    type_var(std::string n)
+        : name(std::move(n)) {}
+
+    void print(const type_mgr& mgr, std::ostream& to) const;
+};
+
+struct type_base : public type {
+    std::string name;
+
+    type_base(std::string n) 
+        : name(std::move(n)) {}
+
+    void print(const type_mgr& mgr, std::ostream& to) const;
+};
+
+struct type_data : public type_base {
+    struct constructor {
+        int tag;
+    };
+
+    std::map<std::string, constructor> constructors;
+
+    type_data(std::string n)
+        : type_base(std::move(n)) {}
+};
+
+struct type_arr : public type {
+    type_ptr left;
+    type_ptr right;
+
+    type_arr(type_ptr l, type_ptr r)
+        : left(std::move(l)), right(std::move(r)) {}
+
+    void print(const type_mgr& mgr, std::ostream& to) const;
+};
+
+struct type_mgr {
+    int last_id = 0;
+    std::map<std::string, type_ptr> types;
+
+    std::string new_type_name();
+    type_ptr new_type();
+    type_ptr new_arrow_type();
+
+    void unify(type_ptr l, type_ptr r);
+    type_ptr resolve(type_ptr t, type_var*& var) const;
+    void bind(const std::string& s, type_ptr t);
+};

code/compiler/09/type_env.cpp

@@ -0,0 +1,16 @@
+#include "type_env.hpp"
+
+type_ptr type_env::lookup(const std::string& name) const {
+    auto it = names.find(name);
+    if(it != names.end()) return it->second;
+    if(parent) return parent->lookup(name);
+    return nullptr;
+}
+
+void type_env::bind(const std::string& name, type_ptr t) {
+    names[name] = t;
+}
+
+type_env type_env::scope() const {
+    return type_env(this);
+}

code/compiler/09/type_env.hpp

@@ -0,0 +1,16 @@
+#pragma once
+#include <map>
+#include "type.hpp"
+
+struct type_env {
+    std::map<std::string, type_ptr> names;
+    type_env const* parent = nullptr;
+
+    type_env(type_env const* p)
+        : parent(p) {}
+    type_env() : type_env(nullptr) {}
+
+    type_ptr lookup(const std::string& name) const;
+    void bind(const std::string& name, type_ptr t);
+    type_env scope() const;
+};

code/compiler/10/CMakeLists.txt

@@ -0,0 +1,43 @@
+cmake_minimum_required(VERSION 3.1)
+project(compiler)
+
+# Find all the required packages
+find_package(BISON)
+find_package(FLEX)
+find_package(LLVM REQUIRED CONFIG)
+
+# Set up the flex and bison targets
+bison_target(parser
+    ${CMAKE_CURRENT_SOURCE_DIR}/parser.y
+    ${CMAKE_CURRENT_BINARY_DIR}/parser.cpp
+    COMPILE_FLAGS "-d")
+flex_target(scanner
+    ${CMAKE_CURRENT_SOURCE_DIR}/scanner.l
+    ${CMAKE_CURRENT_BINARY_DIR}/scanner.cpp)
+add_flex_bison_dependency(scanner parser)
+
+# Find all the relevant LLVM components
+llvm_map_components_to_libnames(LLVM_LIBS core x86asmparser x86codegen)
+
+# Create compiler executable
+add_executable(compiler
+    ast.cpp ast.hpp definition.cpp
+    llvm_context.cpp llvm_context.hpp
+    type_env.cpp type_env.hpp
+    env.cpp env.hpp
+    type.cpp type.hpp
+    error.cpp error.hpp
+    binop.cpp binop.hpp
+    instruction.cpp instruction.hpp
+    graph.cpp graph.hpp
+    ${BISON_parser_OUTPUTS}
+    ${FLEX_scanner_OUTPUTS}
+    main.cpp
+)
+
+# Configure compiler executable
+target_include_directories(compiler PUBLIC ${CMAKE_CURRENT_SOURCE_DIR})
+target_include_directories(compiler PUBLIC ${CMAKE_CURRENT_BINARY_DIR})
+target_include_directories(compiler PUBLIC ${LLVM_INCLUDE_DIRS})
+target_compile_definitions(compiler PUBLIC ${LLVM_DEFINITIONS})
+target_link_libraries(compiler ${LLVM_LIBS})

code/compiler/10/ast.cpp

@@ -0,0 +1,266 @@
+#include "ast.hpp"
+#include <ostream>
+#include "binop.hpp"
+#include "error.hpp"
+#include "type_env.hpp"
+
+static void print_indent(int n, std::ostream& to) {
+    while(n--) to << "  ";
+}
+
+void ast_int::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "INT: " << value << std::endl;
+}
+
+void ast_int::find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into) {
+    this->env = env;
+}
+
+type_ptr ast_int::typecheck(type_mgr& mgr) {
+    return type_ptr(new type_base("Int"));
+}
+
+void ast_int::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    into.push_back(instruction_ptr(new instruction_pushint(value)));
+}
+
+void ast_lid::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "LID: " << id << std::endl;
+}
+
+void ast_lid::find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into) {
+    this->env = env;
+    if(env->lookup(id) == nullptr) into.insert(id);
+}
+
+type_ptr ast_lid::typecheck(type_mgr& mgr) {
+    return env->lookup(id)->instantiate(mgr);
+}
+
+void ast_lid::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    into.push_back(instruction_ptr(
+        env->has_variable(id) ?
+            (instruction*) new instruction_push(env->get_offset(id)) :
+            (instruction*) new instruction_pushglobal(id)));
+}
+
+void ast_uid::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "UID: " << id << std::endl;
+}
+
+void ast_uid::find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into) {
+    this->env = env;
+}
+
+type_ptr ast_uid::typecheck(type_mgr& mgr) {
+    return env->lookup(id)->instantiate(mgr);
+}
+
+void ast_uid::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    into.push_back(instruction_ptr(new instruction_pushglobal(id)));
+}
+
+void ast_binop::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "BINOP: " << op_name(op) << std::endl;
+    left->print(indent + 1, to);
+    right->print(indent + 1, to);
+}
+
+void ast_binop::find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into) {
+    this->env = env;
+    left->find_free(mgr, env, into);
+    right->find_free(mgr, env, into);
+}
+
+type_ptr ast_binop::typecheck(type_mgr& mgr) {
+    type_ptr ltype = left->typecheck(mgr);
+    type_ptr rtype = right->typecheck(mgr);
+    type_ptr ftype = env->lookup(op_name(op))->instantiate(mgr);
+    if(!ftype) throw type_error(std::string("unknown binary operator ") + op_name(op));
+
+    type_ptr return_type = mgr.new_type();
+    type_ptr arrow_one = type_ptr(new type_arr(rtype, return_type));
+    type_ptr arrow_two = type_ptr(new type_arr(ltype, arrow_one));
+
+    mgr.unify(arrow_two, ftype);
+    return return_type;
+}
+
+void ast_binop::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    right->compile(env, into);
+    left->compile(env_ptr(new env_offset(1, env)), into);
+
+    into.push_back(instruction_ptr(new instruction_pushglobal(op_action(op))));
+    into.push_back(instruction_ptr(new instruction_mkapp()));
+    into.push_back(instruction_ptr(new instruction_mkapp()));
+}
+
+void ast_app::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "APP:" << std::endl;
+    left->print(indent + 1, to);
+    right->print(indent + 1, to);
+}
+
+void ast_app::find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into) {
+    this->env = env;
+    left->find_free(mgr, env, into);
+    right->find_free(mgr, env, into);
+}
+
+type_ptr ast_app::typecheck(type_mgr& mgr) {
+    type_ptr ltype = left->typecheck(mgr);
+    type_ptr rtype = right->typecheck(mgr);
+
+    type_ptr return_type = mgr.new_type();
+    type_ptr arrow = type_ptr(new type_arr(rtype, return_type));
+    mgr.unify(arrow, ltype);
+    return return_type;
+}
+
+void ast_app::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    right->compile(env, into);
+    left->compile(env_ptr(new env_offset(1, env)), into);
+    into.push_back(instruction_ptr(new instruction_mkapp()));
+}
+
+void ast_case::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "CASE: " << std::endl;
+    for(auto& branch : branches) {
+        print_indent(indent + 1, to);
+        branch->pat->print(to);
+        to << std::endl;
+        branch->expr->print(indent + 2, to);
+    }
+}
+
+void ast_case::find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into) {
+    this->env = env;
+    of->find_free(mgr, env, into);
+    for(auto& branch : branches) {
+        type_env_ptr new_env = type_scope(env);
+        branch->pat->insert_bindings(mgr, new_env);
+        branch->expr->find_free(mgr, new_env, into);
+    }
+}
+
+type_ptr ast_case::typecheck(type_mgr& mgr) {
+    type_var* var;
+    type_ptr case_type = mgr.resolve(of->typecheck(mgr), var);
+    type_ptr branch_type = mgr.new_type();
+
+    for(auto& branch : branches) {
+        branch->pat->typecheck(case_type, mgr, branch->expr->env);
+        type_ptr curr_branch_type = branch->expr->typecheck(mgr);
+        mgr.unify(branch_type, curr_branch_type);
+    }
+
+    input_type = mgr.resolve(case_type, var);
+    if(!dynamic_cast<type_data*>(input_type.get())) {
+        throw type_error("attempting case analysis of non-data type");
+    }
+
+    return branch_type;
+}
+
+void ast_case::compile(const env_ptr& env, std::vector<instruction_ptr>& into) const {
+    type_data* type = dynamic_cast<type_data*>(input_type.get());
+
+    of->compile(env, into);
+    into.push_back(instruction_ptr(new instruction_eval()));
+
+    instruction_jump* jump_instruction = new instruction_jump();
+    into.push_back(instruction_ptr(jump_instruction));
+    for(auto& branch : branches) {
+        std::vector<instruction_ptr> branch_instructions;
+        pattern_var* vpat;
+        pattern_constr* cpat;
+
+        if((vpat = dynamic_cast<pattern_var*>(branch->pat.get()))) {
+            branch->expr->compile(env_ptr(new env_offset(1, env)), branch_instructions);
+
+            for(auto& constr_pair : type->constructors) {
+                if(jump_instruction->tag_mappings.find(constr_pair.second.tag) !=
+                        jump_instruction->tag_mappings.end())
+                    break;
+
+                jump_instruction->tag_mappings[constr_pair.second.tag] =
+                    jump_instruction->branches.size();
+            }
+            jump_instruction->branches.push_back(std::move(branch_instructions));
+        } else if((cpat = dynamic_cast<pattern_constr*>(branch->pat.get()))) {
+            env_ptr new_env = env;
+            for(auto it = cpat->params.rbegin(); it != cpat->params.rend(); it++) {
+                new_env = env_ptr(new env_var(*it, new_env));
+            }
+
+            branch_instructions.push_back(instruction_ptr(new instruction_split(
+                            cpat->params.size())));
+            branch->expr->compile(new_env, branch_instructions);
+            branch_instructions.push_back(instruction_ptr(new instruction_slide(
+                            cpat->params.size())));
+
+            int new_tag = type->constructors[cpat->constr].tag;
+            if(jump_instruction->tag_mappings.find(new_tag) !=
+                    jump_instruction->tag_mappings.end())
+                throw type_error("technically not a type error: duplicate pattern");
+
+            jump_instruction->tag_mappings[new_tag] =
+                jump_instruction->branches.size();
+            jump_instruction->branches.push_back(std::move(branch_instructions));
+        }
+    }
+
+    for(auto& constr_pair : type->constructors) {
+        if(jump_instruction->tag_mappings.find(constr_pair.second.tag) ==
+                jump_instruction->tag_mappings.end())
+            throw type_error("non-total pattern");
+    }
+}
+
+void pattern_var::print(std::ostream& to) const {
+    to << var;
+}
+
+void pattern_var::insert_bindings(type_mgr& mgr, type_env_ptr& env) const {
+    env->bind(var, mgr.new_type());
+}
+
+void pattern_var::typecheck(type_ptr t, type_mgr& mgr, type_env_ptr& env) const {
+    mgr.unify(env->lookup(var)->instantiate(mgr), t);
+}
+
+void pattern_constr::print(std::ostream& to) const {
+    to << constr;
+    for(auto& param : params) {
+        to << " " << param;
+    }
+}
+
+void pattern_constr::insert_bindings(type_mgr& mgr, type_env_ptr& env) const {
+    for(auto& param : params) {
+        env->bind(param, mgr.new_type());
+    }
+}
+
+void pattern_constr::typecheck(type_ptr t, type_mgr& mgr, type_env_ptr& env) const {
+    type_ptr constructor_type = env->lookup(constr)->instantiate(mgr);
+    if(!constructor_type) {
+        throw type_error(std::string("pattern using unknown constructor ") + constr);
+    }
+
+    for(auto& param : params) {
+        type_arr* arr = dynamic_cast<type_arr*>(constructor_type.get());
+        if(!arr) throw type_error("too many parameters in constructor pattern");
+
+        mgr.unify(env->lookup(param)->instantiate(mgr), arr->left);
+        constructor_type = arr->right;
+    }
+
+    mgr.unify(t, constructor_type);
+}

code/compiler/10/ast.hpp

@@ -0,0 +1,144 @@
+#pragma once
+#include <memory>
+#include <vector>
+#include <set>
+#include "type.hpp"
+#include "type_env.hpp"
+#include "binop.hpp"
+#include "instruction.hpp"
+#include "env.hpp"
+
+struct ast {
+    type_env_ptr env;
+
+    virtual ~ast() = default;
+
+    virtual void print(int indent, std::ostream& to) const = 0;
+    virtual void find_free(type_mgr& mgr,
+        type_env_ptr& env, std::set<std::string>& into) = 0;
+    virtual type_ptr typecheck(type_mgr& mgr) = 0;
+    virtual void compile(const env_ptr& env,
+        std::vector<instruction_ptr>& into) const = 0;
+};
+
+using ast_ptr = std::unique_ptr<ast>;
+
+struct pattern {
+    virtual ~pattern() = default;
+
+    virtual void print(std::ostream& to) const = 0;
+    virtual void insert_bindings(type_mgr& mgr, type_env_ptr& env) const = 0;
+    virtual void typecheck(type_ptr t, type_mgr& mgr, type_env_ptr& env) const = 0;
+};
+
+using pattern_ptr = std::unique_ptr<pattern>;
+
+struct branch {
+    pattern_ptr pat;
+    ast_ptr expr;
+
+    branch(pattern_ptr p, ast_ptr a)
+        : pat(std::move(p)), expr(std::move(a)) {}
+};
+
+using branch_ptr = std::unique_ptr<branch>;
+
+struct ast_int : public ast {
+    int value;
+
+    explicit ast_int(int v)
+        : value(v) {}
+
+    void print(int indent, std::ostream& to) const;
+    void find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into);
+    type_ptr typecheck(type_mgr& mgr);
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct ast_lid : public ast {
+    std::string id;
+
+    explicit ast_lid(std::string i)
+        : id(std::move(i)) {}
+
+    void print(int indent, std::ostream& to) const;
+    void find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into);
+    type_ptr typecheck(type_mgr& mgr);
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct ast_uid : public ast {
+    std::string id;
+
+    explicit ast_uid(std::string i)
+        : id(std::move(i)) {}
+
+    void print(int indent, std::ostream& to) const;
+    void find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into);
+    type_ptr typecheck(type_mgr& mgr);
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct ast_binop : public ast {
+    binop op;  
+    ast_ptr left;
+    ast_ptr right;
+
+    ast_binop(binop o, ast_ptr l, ast_ptr r)
+        : op(o), left(std::move(l)), right(std::move(r)) {}
+
+    void print(int indent, std::ostream& to) const;
+    void find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into);
+    type_ptr typecheck(type_mgr& mgr);
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct ast_app : public ast {
+    ast_ptr left;
+    ast_ptr right;
+
+    ast_app(ast_ptr l, ast_ptr r)
+        : left(std::move(l)), right(std::move(r)) {}
+
+    void print(int indent, std::ostream& to) const;
+    void find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into);
+    type_ptr typecheck(type_mgr& mgr);
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct ast_case : public ast {
+    ast_ptr of;
+    type_ptr input_type;
+    std::vector<branch_ptr> branches;
+
+    ast_case(ast_ptr o, std::vector<branch_ptr> b)
+        : of(std::move(o)), branches(std::move(b)) {}
+
+    void print(int indent, std::ostream& to) const;
+    void find_free(type_mgr& mgr, type_env_ptr& env, std::set<std::string>& into);
+    type_ptr typecheck(type_mgr& mgr);
+    void compile(const env_ptr& env, std::vector<instruction_ptr>& into) const;
+};
+
+struct pattern_var : public pattern {
+    std::string var;
+
+    pattern_var(std::string v)
+        : var(std::move(v)) {}
+
+    void print(std::ostream &to) const;
+    void insert_bindings(type_mgr& mgr, type_env_ptr& env) const;
+    void typecheck(type_ptr t, type_mgr& mgr, type_env_ptr& env) const;
+};
+
+struct pattern_constr : public pattern {
+    std::string constr;
+    std::vector<std::string> params;
+
+    pattern_constr(std::string c, std::vector<std::string> p)
+        : constr(std::move(c)), params(std::move(p)) {}
+
+    void print(std::ostream &to) const;
+    virtual void insert_bindings(type_mgr& mgr, type_env_ptr& env) const;
+    virtual void typecheck(type_ptr t, type_mgr& mgr, type_env_ptr& env) const;
+};

code/compiler/10/binop.cpp

@@ -0,0 +1,21 @@
+#include "binop.hpp"
+
+std::string op_name(binop op) {
+    switch(op) {
+        case PLUS: return "+";
+        case MINUS: return "-";
+        case TIMES: return "*";
+        case DIVIDE: return "/";
+    }
+    return "??";
+}
+
+std::string op_action(binop op) {
+    switch(op) {
+        case PLUS: return "plus";
+        case MINUS: return "minus";
+        case TIMES: return "times";
+        case DIVIDE: return "divide";
+    }
+    return "??";
+}

code/compiler/10/binop.hpp

@@ -0,0 +1,12 @@
+#pragma once
+#include <string>
+
+enum binop {
+    PLUS,
+    MINUS,
+    TIMES,
+    DIVIDE
+};
+
+std::string op_name(binop op);
+std::string op_action(binop op);

code/compiler/10/definition.cpp

@@ -0,0 +1,99 @@
+#include "definition.hpp"
+#include "error.hpp"
+#include "ast.hpp"
+#include "instruction.hpp"
+#include "llvm_context.hpp"
+#include "type.hpp"
+#include "type_env.hpp"
+#include <llvm/IR/DerivedTypes.h>
+#include <llvm/IR/Function.h>
+#include <llvm/IR/Type.h>
+
+void definition_defn::find_free(type_mgr& mgr, type_env_ptr& env) {
+    this->env = env;
+
+    var_env = type_scope(env);
+    return_type = mgr.new_type();
+    full_type = return_type;
+
+    for(auto it = params.rbegin(); it != params.rend(); it++) {
+        type_ptr param_type = mgr.new_type();
+        full_type = type_ptr(new type_arr(param_type, full_type));
+        var_env->bind(*it, param_type);
+    }
+
+    body->find_free(mgr, var_env, free_variables);
+}
+
+void definition_defn::insert_types(type_mgr& mgr) {
+    env->bind(name, full_type);
+}
+
+void definition_defn::typecheck(type_mgr& mgr) {
+    type_ptr body_type = body->typecheck(mgr);
+    mgr.unify(return_type, body_type);
+}
+
+void definition_defn::compile() {
+    env_ptr new_env = env_ptr(new env_offset(0, nullptr));
+    for(auto it = params.rbegin(); it != params.rend(); it++) {
+        new_env = env_ptr(new env_var(*it, new_env));
+    }
+    body->compile(new_env, instructions);
+    instructions.push_back(instruction_ptr(new instruction_update(params.size())));
+    instructions.push_back(instruction_ptr(new instruction_pop(params.size())));
+}
+
+void definition_defn::declare_llvm(llvm_context& ctx) {
+    generated_function = ctx.create_custom_function(name, params.size());
+}
+
+void definition_defn::generate_llvm(llvm_context& ctx) {
+    ctx.builder.SetInsertPoint(&generated_function->getEntryBlock());
+    for(auto& instruction : instructions) {
+        instruction->gen_llvm(ctx, generated_function);
+    }
+    ctx.builder.CreateRetVoid();
+}
+
+void definition_data::insert_types(type_mgr& mgr, type_env_ptr& env) {
+    this->env = env;
+    env->bind_type(name, type_ptr(new type_data(name)));
+}
+
+void definition_data::insert_constructors() const {
+    type_ptr return_type = env->lookup_type(name);
+    type_data* this_type = static_cast<type_data*>(return_type.get());
+    int next_tag = 0;
+
+    for(auto& constructor : constructors) {
+        constructor->tag = next_tag;
+        this_type->constructors[constructor->name] = { next_tag++ };
+
+        type_ptr full_type = return_type;
+        for(auto it = constructor->types.rbegin(); it != constructor->types.rend(); it++) {
+            type_ptr type = env->lookup_type(*it);
+            if(!type) throw 0;
+            full_type = type_ptr(new type_arr(type, full_type));
+        }
+
+        env->bind(constructor->name, full_type);
+    }
+}
+
+void definition_data::generate_llvm(llvm_context& ctx) {
+    for(auto& constructor : constructors) {
+        auto new_function =
+            ctx.create_custom_function(constructor->name, constructor->types.size());
+        std::vector<instruction_ptr> instructions;
+        instructions.push_back(instruction_ptr(
+                new instruction_pack(constructor->tag, constructor->types.size())
+        ));
+        instructions.push_back(instruction_ptr(new instruction_update(0)));
+        ctx.builder.SetInsertPoint(&new_function->getEntryBlock());
+        for (auto& instruction : instructions) {
+            instruction->gen_llvm(ctx, new_function);
+        }
+        ctx.builder.CreateRetVoid();
+    }
+}

code/compiler/10/definition.hpp

@@ -0,0 +1,67 @@
+#pragma once
+#include <memory>
+#include <vector>
+#include <set>
+#include "instruction.hpp"
+#include "llvm_context.hpp"
+#include "type_env.hpp"
+
+struct ast;
+using ast_ptr = std::unique_ptr<ast>;
+
+struct constructor {
+    std::string name;
+    std::vector<std::string> types;
+    int8_t tag;
+
+    constructor(std::string n, std::vector<std::string> ts)
+        : name(std::move(n)), types(std::move(ts)) {}
+};
+
+using constructor_ptr = std::unique_ptr<constructor>;
+
+struct definition_defn {
+    std::string name;
+    std::vector<std::string> params;
+    ast_ptr body;
+
+    type_env_ptr env;
+    type_env_ptr var_env;
+    std::set<std::string> free_variables;
+    type_ptr full_type;
+    type_ptr return_type;
+
+    std::vector<instruction_ptr> instructions;
+
+    llvm::Function* generated_function;
+
+    definition_defn(std::string n, std::vector<std::string> p, ast_ptr b)
+        : name(std::move(n)), params(std::move(p)), body(std::move(b)) {
+
+    }
+
+    void find_free(type_mgr& mgr, type_env_ptr& env);
+    void insert_types(type_mgr& mgr);
+    void typecheck(type_mgr& mgr);
+    void compile();
+    void declare_llvm(llvm_context& ctx);
+    void generate_llvm(llvm_context& ctx);
+};
+
+using definition_defn_ptr = std::unique_ptr<definition_defn>;
+
+struct definition_data {
+    std::string name;
+    std::vector<constructor_ptr> constructors;
+
+    type_env_ptr env;
+
+    definition_data(std::string n, std::vector<constructor_ptr> cs)
+        : name(std::move(n)), constructors(std::move(cs)) {}
+
+    void insert_types(type_mgr& mgr, type_env_ptr& env);
+    void insert_constructors() const;
+    void generate_llvm(llvm_context& ctx);
+};
+
+using definition_data_ptr = std::unique_ptr<definition_data>;

code/compiler/10/env.cpp

@@ -0,0 +1,23 @@
+#include "env.hpp"
+
+int env_var::get_offset(const std::string& name) const {
+    if(name == this->name) return 0;
+    if(parent) return parent->get_offset(name) + 1;
+    throw 0;
+}
+
+bool env_var::has_variable(const std::string& name) const {
+    if(name == this->name) return true;
+    if(parent) return parent->has_variable(name);
+    return false;
+}
+
+int env_offset::get_offset(const std::string& name) const {
+    if(parent) return parent->get_offset(name) + offset;
+    throw 0;
+}
+
+bool env_offset::has_variable(const std::string& name) const {
+    if(parent) return parent->has_variable(name);
+    return false;
+}

code/compiler/10/env.hpp

@@ -0,0 +1,34 @@
+#pragma once
+#include <memory>
+#include <string>
+
+struct env {
+    virtual ~env() = default;
+
+    virtual int get_offset(const std::string& name) const = 0;
+    virtual bool has_variable(const std::string& name) const = 0;
+};
+
+using env_ptr = std::shared_ptr<env>;
+
+struct env_var : public env {
+    std::string name;
+    env_ptr parent;
+
+    env_var(std::string& n, env_ptr p)
+        : name(std::move(n)), parent(std::move(p)) {}
+
+    int get_offset(const std::string& name) const;
+    bool has_variable(const std::string& name) const;
+};
+
+struct env_offset : public env {
+    int offset;
+    env_ptr parent;
+
+    env_offset(int o, env_ptr p)
+        : offset(o), parent(std::move(p)) {}
+
+    int get_offset(const std::string& name) const;
+    bool has_variable(const std::string& name) const;
+};

code/compiler/10/error.cpp

@@ -0,0 +1,5 @@
+#include "error.hpp"
+
+const char* type_error::what() const noexcept {
+    return "an error occured while checking the types of the program";
+}

code/compiler/10/error.hpp

@@ -0,0 +1,21 @@
+#pragma once
+#include <exception>
+#include "type.hpp"
+
+struct type_error : std::exception {
+    std::string description;
+
+    type_error(std::string d)
+        : description(std::move(d)) {}
+
+    const char* what() const noexcept override;
+};
+
+struct unification_error : public type_error {
+    type_ptr left;
+    type_ptr right;
+
+    unification_error(type_ptr l, type_ptr r)
+        : left(std::move(l)), right(std::move(r)), 
+            type_error("failed to unify types") {}
+};

code/compiler/10/examples/bad1.txt

@@ -0,0 +1,2 @@
+data Bool = { True, False }
+defn main = { 3 + True }

code/compiler/10/examples/bad2.txt

@@ -0,0 +1 @@
+defn main = { 1 2 3 4 5 }

code/compiler/10/examples/bad3.txt

@@ -0,0 +1,8 @@
+data List = { Nil, Cons Int List }
+
+defn head l = {
+    case l of {
+        Nil -> { 0 }
+        Cons x y z -> { x }
+    }
+}

code/compiler/10/examples/if.txt

@@ -0,0 +1,8 @@
+data Bool = { True, False }
+defn if c t e = {
+    case c of {
+        True -> { t }
+        False -> { e }
+    }
+}
+defn main = { if (if True False True) 11 3 }

code/compiler/10/examples/primes.txt

@@ -0,0 +1,129 @@
+data List = { Nil, Cons Nat List }
+data Bool = { True, False }
+data Nat = { O, S Nat }
+
+defn ifN c t e = {
+    case c of {
+        True -> { t }
+        False -> { e }
+    }
+}
+
+defn ifL c t e = {
+    case c of {
+        True -> { t }
+        False -> { e }
+    }
+}
+
+defn toInt n = {
+    case n of {
+        O -> { 0 }
+        S np -> { 1 + toInt np }
+    }
+}
+
+defn lte n m = {
+    case m of {
+        O -> {
+            case n of {
+                O -> { True }
+                S np -> { False }
+            }
+        }
+        S mp -> {
+            case n of {
+                O -> { True }
+                S np -> { lte np mp }
+            }
+        }
+    }
+}
+
+defn minus n m = {
+    case m of {
+        O -> { n }
+        S mp -> { 
+            case n of {
+                O -> { O }
+                S np -> {
+                    minus np mp
+                }
+            }
+        }
+    }
+}
+
+defn mod n m = {
+    ifN (lte m n) (mod (minus n m) m) n
+}
+
+defn notDivisibleBy n m = {
+    case (mod m n) of {
+        O -> { False }
+        S mp -> { True }
+    }
+}
+
+defn filter f l = {
+    case l of {
+        Nil -> { Nil }
+        Cons x xs -> { ifL (f x) (Cons x (filter f xs)) (filter f xs) }
+    }
+}
+
+defn map f l = {
+    case l of {
+        Nil -> { Nil }
+        Cons x xs -> { Cons (f x) (map f xs) }
+    }
+}
+
+defn nats = {
+    Cons (S (S O)) (map S nats)
+}
+
+defn primesRec l = {
+    case l of {
+        Nil -> { Nil }
+        Cons p xs -> { Cons p (primesRec (filter (notDivisibleBy p) xs)) }
+    }
+}
+
+defn primes = {
+    primesRec nats
+}
+
+defn take n l = {
+    case l of {
+        Nil -> { Nil }
+        Cons x xs -> {
+            case n of {
+                O -> { Nil }
+                S np -> { Cons x (take np xs) }
+            }
+        }
+    }
+}
+
+defn head l = {
+    case l of {
+        Nil -> { O }
+        Cons x xs -> { x }
+    }
+}
+
+defn reverseAcc a l = {
+    case l of {
+        Nil -> { a }
+        Cons x xs -> { reverseAcc (Cons x a) xs }
+    }
+}
+
+defn reverse l = {
+    reverseAcc Nil l
+}
+
+defn main = {
+    toInt (head (reverse (take ((S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S (S O))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) primes)))
+}

code/compiler/10/examples/runtime1.c

@@ -0,0 +1,31 @@
+#include "../runtime.h"
+
+void f_add(struct stack* s) {
+    struct node_num* left = (struct node_num*) eval(stack_peek(s, 0));
+    struct node_num* right = (struct node_num*) eval(stack_peek(s, 1));
+    stack_push(s, (struct node_base*) alloc_num(left->value + right->value));
+}
+
+void f_main(struct stack* s) {
+    // PushInt 320
+    stack_push(s, (struct node_base*) alloc_num(320));
+
+    // PushInt 6
+    stack_push(s, (struct node_base*) alloc_num(6));
+
+    // PushGlobal f_add (the function for +)
+    stack_push(s, (struct node_base*) alloc_global(f_add, 2));
+
+    struct node_base* left;
+    struct node_base* right;
+    
+    // MkApp
+    left = stack_pop(s);
+    right = stack_pop(s);
+    stack_push(s, (struct node_base*) alloc_app(left, right));
+    
+    // MkApp
+    left = stack_pop(s);
+    right = stack_pop(s);
+    stack_push(s, (struct node_base*) alloc_app(left, right));
+}

code/compiler/10/examples/works1.txt

@@ -0,0 +1,2 @@
+defn main = { sum 320 6 }
+defn sum x y = { x + y }

code/compiler/10/examples/works2.txt

@@ -0,0 +1,3 @@
+defn add x y = { x + y }
+defn double x = { add x x }
+defn main = { double 163 }

code/compiler/10/examples/works3.txt

@@ -0,0 +1,8 @@
+data List = { Nil, Cons Int List }
+defn length l = {
+    case l of {
+        Nil -> { 0 }
+        Cons x xs -> { 1 + length xs }
+    }
+}
+defn main = { length (Cons 1 (Cons 2 (Cons 3 Nil))) }

code/compiler/10/examples/works4.txt

@@ -0,0 +1,16 @@
+data List = { Nil, Cons Int List }
+
+defn add x y = { x + y }
+defn mul x y = { x * y }
+
+defn foldr f b l = {
+    case l of {
+        Nil -> { b }
+        Cons x xs -> { f x (foldr f b xs) }
+    }
+}
+
+defn main = {
+    foldr add 0 (Cons 1 (Cons 2 (Cons 3 (Cons 4 Nil)))) +
+    foldr mul 1 (Cons 1 (Cons 2 (Cons 3 (Cons 4 Nil))))
+}

code/compiler/10/examples/works5.txt

@@ -0,0 +1,17 @@
+data List = { Nil, Cons Int List }
+
+defn sumZip l m = {
+    case l of {
+        Nil -> { 0 }
+        Cons x xs -> {
+            case m of {
+                Nil -> { 0 }
+                Cons y ys -> { x + y + sumZip xs ys }
+            }
+        }
+    }
+}
+
+defn ones = { Cons 1 ones }
+
+defn main = { sumZip ones (Cons 1 (Cons 2 (Cons 3 Nil))) }

code/compiler/10/graph.cpp

@@ -0,0 +1,114 @@
+#include "graph.hpp"
+
+std::set<function_graph::edge> function_graph::compute_transitive_edges() {
+    std::set<edge> transitive_edges;
+    transitive_edges.insert(edges.begin(), edges.end());
+    for(auto& connector : adjacency_lists) {
+        for(auto& from : adjacency_lists) {
+            edge to_connector { from.first, connector.first };
+            for(auto& to : adjacency_lists) {
+                edge full_jump { from.first, to.first };
+                if(transitive_edges.find(full_jump) != transitive_edges.end()) continue;
+
+                edge from_connector { connector.first, to.first };
+                if(transitive_edges.find(to_connector) != transitive_edges.end() &&
+                        transitive_edges.find(from_connector) != transitive_edges.end())
+                    transitive_edges.insert(std::move(full_jump));
+            }
+        }
+    }
+    return transitive_edges;
+}
+
+void function_graph::create_groups(
+        const std::set<edge>& transitive_edges,
+        std::map<function, group_id>& group_ids,
+        std::map<group_id, data_ptr>& group_data_map) {
+    group_id id_counter = 0;
+    for(auto& vertex : adjacency_lists) {
+        if(group_ids.find(vertex.first) != group_ids.end())
+            continue;
+        data_ptr new_group(new group_data);
+        new_group->functions.insert(vertex.first);
+        group_data_map[id_counter] = new_group;
+        group_ids[vertex.first] = id_counter;
+        for(auto& other_vertex : adjacency_lists) {
+            if(transitive_edges.find({vertex.first, other_vertex.first}) != transitive_edges.end() &&
+                    transitive_edges.find({other_vertex.first, vertex.first}) != transitive_edges.end()) {
+                group_ids[other_vertex.first] = id_counter;
+                new_group->functions.insert(other_vertex.first);
+            }
+        }
+        id_counter++;
+    }
+}
+
+void function_graph::create_edges(
+        std::map<function, group_id>& group_ids,
+        std::map<group_id, data_ptr>& group_data_map) {
+    std::set<std::pair<group_id, group_id>> group_edges;
+    for(auto& vertex : adjacency_lists) {
+        auto vertex_id = group_ids[vertex.first];
+        auto& vertex_data = group_data_map[vertex_id];
+        for(auto& other_vertex : vertex.second) {
+            auto other_id = group_ids[other_vertex];
+            if(vertex_id == other_id) continue;
+            if(group_edges.find({vertex_id, other_id}) != group_edges.end())
+                continue;
+            group_edges.insert({vertex_id, other_id});
+            vertex_data->adjacency_list.insert(other_id);
+            group_data_map[other_id]->indegree++;
+        }
+    }
+}
+
+std::vector<group_ptr> function_graph::generate_order(
+        std::map<function, group_id>& group_ids,
+        std::map<group_id, data_ptr>& group_data_map) {
+    std::queue<group_id> id_queue;
+    std::vector<group_ptr> output;
+    for(auto& group : group_data_map) {
+        if(group.second->indegree == 0) id_queue.push(group.first);
+    }
+
+    while(!id_queue.empty()) {
+        auto new_id = id_queue.front();
+        auto& group_data = group_data_map[new_id];
+        group_ptr output_group(new group);
+        output_group->members = std::move(group_data->functions);
+        id_queue.pop();
+
+        for(auto& adjacent_group : group_data->adjacency_list) {
+            if(--group_data_map[adjacent_group]->indegree == 0)
+                id_queue.push(adjacent_group);
+        }
+
+        output.push_back(std::move(output_group));
+    }
+
+    return output;
+}
+
+std::set<function>& function_graph::add_function(const function& f) {
+    auto adjacency_list_it = adjacency_lists.find(f);
+    if(adjacency_list_it != adjacency_lists.end()) {
+        return adjacency_list_it->second;
+    } else {
+        return adjacency_lists[f] = { };
+    }
+}
+
+void function_graph::add_edge(const function& from, const function& to) {
+    add_function(from).insert(to);
+    edges.insert({ from, to });
+}
+
+std::vector<group_ptr> function_graph::compute_order() {
+    std::set<edge> transitive_edges = compute_transitive_edges();
+    std::map<function, group_id> group_ids;
+    std::map<group_id, data_ptr> group_data_map;
+
+    create_groups(transitive_edges, group_ids, group_data_map);
+    create_edges(group_ids, group_data_map);
+    return generate_order(group_ids, group_data_map);
+}

code/compiler/10/graph.hpp

@@ -0,0 +1,52 @@
+#pragma once
+#include <algorithm>
+#include <cstddef>
+#include <queue>
+#include <set>
+#include <string>
+#include <map>
+#include <memory>
+#include <vector>
+#include <iostream>
+
+using function = std::string;
+
+struct group {
+    std::set<function> members;
+};
+
+using group_ptr = std::unique_ptr<group>;
+
+class function_graph {
+    using group_id = size_t;
+
+    struct group_data {
+        std::set<function> functions;
+        std::set<group_id> adjacency_list;
+        size_t indegree;
+    };
+
+    using data_ptr = std::shared_ptr<group_data>;
+    using edge = std::pair<function, function>;
+    using group_edge = std::pair<group_id, group_id>;
+
+    std::map<function, std::set<function>> adjacency_lists;
+    std::set<edge> edges;
+
+    std::set<edge> compute_transitive_edges();
+    void create_groups(
+            const std::set<edge>&,
+            std::map<function, group_id>&,
+            std::map<group_id, data_ptr>&);
+    void create_edges(
+            std::map<function, group_id>&,
+            std::map<group_id, data_ptr>&);
+    std::vector<group_ptr> generate_order(
+            std::map<function, group_id>&,
+            std::map<group_id, data_ptr>&);
+    
+    public:
+    std::set<function>& add_function(const function& f);
+    void add_edge(const function& from, const function& to);
+    std::vector<group_ptr> compute_order();
+};

code/compiler/10/instruction.cpp

@@ -0,0 +1,177 @@
+#include "instruction.hpp"
+#include "llvm_context.hpp"
+#include <llvm/IR/BasicBlock.h>
+#include <llvm/IR/Function.h>
+
+using namespace llvm;
+
+static void print_indent(int n, std::ostream& to) {
+    while(n--) to << "  ";
+}
+
+void instruction_pushint::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "PushInt(" << value << ")" << std::endl;
+}
+
+void instruction_pushint::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_push(f, ctx.create_num(f, ctx.create_i32(value)));
+}
+
+void instruction_pushglobal::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "PushGlobal(" << name << ")" << std::endl;
+}
+
+void instruction_pushglobal::gen_llvm(llvm_context& ctx, Function* f) const {
+    auto& global_f = ctx.custom_functions.at("f_" + name);
+    auto arity = ctx.create_i32(global_f->arity);
+    ctx.create_push(f, ctx.create_global(f, global_f->function, arity));
+}
+
+void instruction_push::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Push(" << offset << ")" << std::endl;
+}
+
+void instruction_push::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_push(f, ctx.create_peek(f, ctx.create_size(offset)));
+}
+
+void instruction_pop::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Pop(" << count << ")" << std::endl;
+}
+
+void instruction_pop::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_popn(f, ctx.create_size(count));
+}
+
+void instruction_mkapp::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "MkApp()" << std::endl;
+}
+
+void instruction_mkapp::gen_llvm(llvm_context& ctx, Function* f) const {
+    auto left = ctx.create_pop(f);
+    auto right = ctx.create_pop(f);
+    ctx.create_push(f, ctx.create_app(f, left, right));
+}
+
+void instruction_update::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Update(" << offset << ")" << std::endl;
+}
+
+void instruction_update::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_update(f, ctx.create_size(offset));
+}
+
+void instruction_pack::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Pack(" << tag << ", " << size << ")" << std::endl;
+}
+
+void instruction_pack::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_pack(f, ctx.create_size(size), ctx.create_i8(tag));
+}
+
+void instruction_split::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Split()" << std::endl;
+}
+
+void instruction_split::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_split(f, ctx.create_size(size));
+}
+
+void instruction_jump::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Jump(" << std::endl;
+    for(auto& instruction_set : branches) {
+        for(auto& instruction : instruction_set) {
+            instruction->print(indent + 2, to);
+        }
+        to << std::endl;
+    }
+    print_indent(indent, to);
+    to << ")" << std::endl;
+}
+
+void instruction_jump::gen_llvm(llvm_context& ctx, Function* f) const {
+    auto top_node = ctx.create_peek(f, ctx.create_size(0));
+    auto tag = ctx.unwrap_data_tag(top_node);
+    auto safety_block = BasicBlock::Create(ctx.ctx, "safety", f);
+    auto switch_op = ctx.builder.CreateSwitch(tag, safety_block, tag_mappings.size());
+    std::vector<BasicBlock*> blocks;
+
+    for(auto& branch : branches) {
+        auto branch_block = BasicBlock::Create(ctx.ctx, "branch", f);
+        ctx.builder.SetInsertPoint(branch_block);
+        for(auto& instruction : branch) {
+            instruction->gen_llvm(ctx, f);
+        }
+        ctx.builder.CreateBr(safety_block);
+        blocks.push_back(branch_block);
+    }
+
+    for(auto& mapping : tag_mappings) {
+        switch_op->addCase(ctx.create_i8(mapping.first), blocks[mapping.second]);
+    }
+
+    ctx.builder.SetInsertPoint(safety_block);
+}
+
+void instruction_slide::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Slide(" << offset << ")" << std::endl;
+}
+
+void instruction_slide::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_slide(f, ctx.create_size(offset));
+}
+
+void instruction_binop::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "BinOp(" << op_action(op) << ")" << std::endl;
+}
+
+void instruction_binop::gen_llvm(llvm_context& ctx, Function* f) const {
+    auto left_int = ctx.unwrap_num(ctx.create_pop(f));
+    auto right_int = ctx.unwrap_num(ctx.create_pop(f));
+    llvm::Value* result;
+    switch(op) {
+        case PLUS: result = ctx.builder.CreateAdd(left_int, right_int); break;
+        case MINUS: result = ctx.builder.CreateSub(left_int, right_int); break;
+        case TIMES: result = ctx.builder.CreateMul(left_int, right_int); break;
+        case DIVIDE: result = ctx.builder.CreateSDiv(left_int, right_int); break;
+    }
+    ctx.create_push(f, ctx.create_num(f, result));
+}
+
+void instruction_eval::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Eval()" << std::endl;
+}
+
+void instruction_eval::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_unwind(f);
+}
+
+void instruction_alloc::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Alloc(" << amount << ")" << std::endl;
+}
+
+void instruction_alloc::gen_llvm(llvm_context& ctx, Function* f) const {
+    ctx.create_alloc(f, ctx.create_size(amount));
+}
+
+void instruction_unwind::print(int indent, std::ostream& to) const {
+    print_indent(indent, to);
+    to << "Unwind()" << std::endl;
+}
+
+void instruction_unwind::gen_llvm(llvm_context& ctx, Function* f) const {
+    // Nothing
+}

code/compiler/10/instruction.hpp

@@ -0,0 +1,142 @@
+#pragma once
+#include <llvm/IR/Function.h>
+#include <string>
+#include <memory>
+#include <vector>
+#include <map>
+#include <ostream>
+#include "binop.hpp"
+#include "llvm_context.hpp"
+
+struct instruction {
+    virtual ~instruction() = default;
+
+    virtual void print(int indent, std::ostream& to) const = 0;
+    virtual void gen_llvm(llvm_context& ctx, llvm::Function* f) const = 0;
+};
+
+using instruction_ptr = std::unique_ptr<instruction>;
+
+struct instruction_pushint : public instruction {
+    int value;
+
+    instruction_pushint(int v)
+        : value(v) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_pushglobal : public instruction {
+    std::string name;
+
+    instruction_pushglobal(std::string n)
+        : name(std::move(n)) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_push : public instruction {
+    int offset;
+
+    instruction_push(int o)
+        : offset(o) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_pop : public instruction {
+    int count;
+
+    instruction_pop(int c)
+        : count(c) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_mkapp : public instruction {
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_update : public instruction {
+    int offset;
+
+    instruction_update(int o)
+        : offset(o) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_pack : public instruction {
+    int tag;
+    int size;
+
+    instruction_pack(int t, int s)
+        : tag(t), size(s) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_split : public instruction {
+    int size;
+
+    instruction_split(int s)
+        : size(s) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_jump : public instruction {
+    std::vector<std::vector<instruction_ptr>> branches;
+    std::map<int, int> tag_mappings;
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_slide : public instruction {
+    int offset;
+
+    instruction_slide(int o)
+        : offset(o) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_binop : public instruction {
+    binop op;
+
+    instruction_binop(binop o)
+        : op(o) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_eval : public instruction {
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_alloc : public instruction {
+    int amount;
+
+    instruction_alloc(int a)
+        : amount(a) {}
+
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};
+
+struct instruction_unwind : public instruction {
+    void print(int indent, std::ostream& to) const;
+    void gen_llvm(llvm_context& ctx, llvm::Function* f) const;
+};

code/compiler/10/llvm_context.cpp

@@ -0,0 +1,278 @@
+#include "llvm_context.hpp"
+#include <llvm/IR/DerivedTypes.h>
+
+using namespace llvm;
+
+void llvm_context::create_types() {
+    stack_type = StructType::create(ctx, "stack");
+    gmachine_type = StructType::create(ctx, "gmachine");
+    stack_ptr_type = PointerType::getUnqual(stack_type);
+    gmachine_ptr_type = PointerType::getUnqual(gmachine_type);
+    tag_type = IntegerType::getInt8Ty(ctx);
+    struct_types["node_base"] = StructType::create(ctx, "node_base");
+    struct_types["node_app"] = StructType::create(ctx, "node_app");
+    struct_types["node_num"] = StructType::create(ctx, "node_num");
+    struct_types["node_global"] = StructType::create(ctx, "node_global");
+    struct_types["node_ind"] = StructType::create(ctx, "node_ind");
+    struct_types["node_data"] = StructType::create(ctx, "node_data");
+    node_ptr_type = PointerType::getUnqual(struct_types.at("node_base"));
+    function_type = FunctionType::get(Type::getVoidTy(ctx), { gmachine_ptr_type }, false);
+
+    gmachine_type->setBody(
+            stack_ptr_type,
+            node_ptr_type,
+            IntegerType::getInt64Ty(ctx),
+            IntegerType::getInt64Ty(ctx)
+    );
+    struct_types.at("node_base")->setBody(
+            IntegerType::getInt32Ty(ctx),
+            IntegerType::getInt8Ty(ctx),
+            node_ptr_type
+    );
+    struct_types.at("node_app")->setBody(
+            struct_types.at("node_base"),
+            node_ptr_type,
+            node_ptr_type
+    );
+    struct_types.at("node_num")->setBody(
+            struct_types.at("node_base"),
+            IntegerType::getInt32Ty(ctx)
+    );
+    struct_types.at("node_global")->setBody(
+            struct_types.at("node_base"),
+            FunctionType::get(Type::getVoidTy(ctx), { stack_ptr_type }, false)
+    );
+    struct_types.at("node_ind")->setBody(
+            struct_types.at("node_base"),
+            node_ptr_type
+    );
+    struct_types.at("node_data")->setBody(
+            struct_types.at("node_base"),
+            IntegerType::getInt8Ty(ctx),
+            PointerType::getUnqual(node_ptr_type)
+    );
+}
+
+void llvm_context::create_functions() {
+    auto void_type = Type::getVoidTy(ctx);
+    auto sizet_type = IntegerType::get(ctx, sizeof(size_t) * 8);
+    functions["stack_init"] = Function::Create(
+            FunctionType::get(void_type, { stack_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_init",
+            &module
+    );
+    functions["stack_free"] = Function::Create(
+            FunctionType::get(void_type, { stack_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_free",
+            &module
+    );
+    functions["stack_push"] = Function::Create(
+            FunctionType::get(void_type, { stack_ptr_type, node_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_push",
+            &module
+    );
+    functions["stack_pop"] = Function::Create(
+            FunctionType::get(node_ptr_type, { stack_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_pop",
+            &module
+    );
+    functions["stack_peek"] = Function::Create(
+            FunctionType::get(node_ptr_type, { stack_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_peek",
+            &module
+    );
+    functions["stack_popn"] = Function::Create(
+            FunctionType::get(void_type, { stack_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "stack_popn",
+            &module
+    );
+    functions["gmachine_slide"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_slide",
+            &module
+    );
+    functions["gmachine_update"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_update",
+            &module
+    );
+    functions["gmachine_alloc"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_alloc",
+            &module
+    );
+    functions["gmachine_pack"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type, sizet_type, tag_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_pack",
+            &module
+    );
+    functions["gmachine_split"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type, sizet_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_split",
+            &module
+    );
+    functions["gmachine_track"] = Function::Create(
+            FunctionType::get(node_ptr_type, { gmachine_ptr_type, node_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "gmachine_track",
+            &module
+    );
+
+    auto int32_type = IntegerType::getInt32Ty(ctx);
+    functions["alloc_app"] = Function::Create(
+            FunctionType::get(node_ptr_type, { node_ptr_type, node_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "alloc_app",
+            &module
+    );
+    functions["alloc_num"] = Function::Create(
+            FunctionType::get(node_ptr_type, { int32_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "alloc_num",
+            &module
+    );
+    functions["alloc_global"] = Function::Create(
+            FunctionType::get(node_ptr_type, { function_type, int32_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "alloc_global",
+            &module
+    );
+    functions["alloc_ind"] = Function::Create(
+            FunctionType::get(node_ptr_type, { node_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "alloc_ind",
+            &module
+    );
+
+    functions["unwind"] = Function::Create(
+            FunctionType::get(void_type, { gmachine_ptr_type }, false),
+            Function::LinkageTypes::ExternalLinkage,
+            "unwind",
+            &module
+    );
+}
+
+ConstantInt* llvm_context::create_i8(int8_t i) {
+    return ConstantInt::get(ctx, APInt(8, i));
+}
+ConstantInt* llvm_context::create_i32(int32_t i) {
+    return ConstantInt::get(ctx, APInt(32, i));
+}
+ConstantInt* llvm_context::create_size(size_t i) {
+    return ConstantInt::get(ctx, APInt(sizeof(size_t) * 8, i));
+}
+
+Value* llvm_context::create_pop(Function* f) {
+    auto pop_f = functions.at("stack_pop");
+    return builder.CreateCall(pop_f, { unwrap_gmachine_stack_ptr(f->arg_begin()) });
+}
+Value* llvm_context::create_peek(Function* f, Value* off) {
+    auto peek_f = functions.at("stack_peek");
+    return builder.CreateCall(peek_f, { unwrap_gmachine_stack_ptr(f->arg_begin()), off });
+}
+void llvm_context::create_push(Function* f, Value* v) {
+    auto push_f = functions.at("stack_push");
+    builder.CreateCall(push_f, { unwrap_gmachine_stack_ptr(f->arg_begin()), v });
+}
+void llvm_context::create_popn(Function* f, Value* off) {
+    auto popn_f = functions.at("stack_popn");
+    builder.CreateCall(popn_f, { unwrap_gmachine_stack_ptr(f->arg_begin()), off });
+}
+void llvm_context::create_update(Function* f, Value* off) {
+    auto update_f = functions.at("gmachine_update");
+    builder.CreateCall(update_f, { f->arg_begin(), off });
+}
+void llvm_context::create_pack(Function* f, Value* c, Value* t) {
+    auto pack_f = functions.at("gmachine_pack");
+    builder.CreateCall(pack_f, { f->arg_begin(), c, t });
+}
+void llvm_context::create_split(Function* f, Value* c) {
+    auto split_f = functions.at("gmachine_split");
+    builder.CreateCall(split_f, { f->arg_begin(), c });
+}
+void llvm_context::create_slide(Function* f, Value* off) {
+    auto slide_f = functions.at("gmachine_slide");
+    builder.CreateCall(slide_f, { f->arg_begin(), off });
+}
+void llvm_context::create_alloc(Function* f, Value* n) {
+    auto alloc_f = functions.at("gmachine_alloc");
+    builder.CreateCall(alloc_f, { f->arg_begin(), n });
+}
+Value* llvm_context::create_track(Function* f, Value* v) {
+    auto track_f = functions.at("gmachine_track");
+    return builder.CreateCall(track_f, { f->arg_begin(), v });
+}
+
+void llvm_context::create_unwind(Function* f) {
+    auto unwind_f = functions.at("unwind");
+    builder.CreateCall(unwind_f, { f->args().begin() });
+}
+
+Value* llvm_context::unwrap_gmachine_stack_ptr(Value* g) {
+    auto offset_0 = create_i32(0);
+    return builder.CreateGEP(g, { offset_0, offset_0 });
+}
+
+Value* llvm_context::unwrap_num(Value* v) {
+    auto num_ptr_type = PointerType::getUnqual(struct_types.at("node_num"));
+    auto cast = builder.CreatePointerCast(v, num_ptr_type);
+    auto offset_0 = create_i32(0);
+    auto offset_1 = create_i32(1);
+    auto int_ptr = builder.CreateGEP(cast, { offset_0, offset_1 });
+    return builder.CreateLoad(int_ptr);
+}
+Value* llvm_context::create_num(Function* f, Value* v) {
+    auto alloc_num_f = functions.at("alloc_num");
+    auto alloc_num_call = builder.CreateCall(alloc_num_f, { v });
+    return create_track(f, alloc_num_call);
+}
+
+Value* llvm_context::unwrap_data_tag(Value* v) {
+    auto data_ptr_type = PointerType::getUnqual(struct_types.at("node_data"));
+    auto cast = builder.CreatePointerCast(v, data_ptr_type);
+    auto offset_0 = create_i32(0);
+    auto offset_1 = create_i32(1);
+    auto tag_ptr = builder.CreateGEP(cast, { offset_0, offset_1 });
+    return builder.CreateLoad(tag_ptr);
+}
+
+Value* llvm_context::create_global(Function* f, Value* gf, Value* a) {
+    auto alloc_global_f = functions.at("alloc_global");
+    auto alloc_global_call = builder.CreateCall(alloc_global_f, { gf, a });
+    return create_track(f, alloc_global_call);
+}
+
+Value* llvm_context::create_app(Function* f, Value* l, Value* r) {
+    auto alloc_app_f = functions.at("alloc_app");
+    auto alloc_app_call = builder.CreateCall(alloc_app_f, { l, r });
+    return create_track(f, alloc_app_call);
+}
+
+llvm::Function* llvm_context::create_custom_function(std::string name, int32_t arity) {
+    auto void_type = llvm::Type::getVoidTy(ctx);
+    auto new_function = llvm::Function::Create(
+            function_type,
+            llvm::Function::LinkageTypes::ExternalLinkage,
+            "f_" + name,
+            &module
+    );
+    auto start_block = llvm::BasicBlock::Create(ctx, "entry", new_function);
+
+    auto new_custom_f = custom_function_ptr(new custom_function());
+    new_custom_f->arity = arity;
+    new_custom_f->function = new_function;
+    custom_functions["f_" + name] = std::move(new_custom_f);
+
+    return new_function;
+}

code/compiler/10/llvm_context.hpp

@@ -0,0 +1,72 @@
+#pragma once
+#include <llvm/IR/DerivedTypes.h>
+#include <llvm/IR/Function.h>
+#include <llvm/IR/LLVMContext.h>
+#include <llvm/IR/IRBuilder.h>
+#include <llvm/IR/Module.h>
+#include <llvm/IR/Value.h>
+#include <map>
+
+struct llvm_context {
+    struct custom_function {
+        llvm::Function* function;
+        int32_t arity;
+    };
+
+    using custom_function_ptr = std::unique_ptr<custom_function>;
+
+    llvm::LLVMContext ctx;
+    llvm::IRBuilder<> builder;
+    llvm::Module module;
+
+    std::map<std::string, custom_function_ptr> custom_functions;
+    std::map<std::string, llvm::Function*> functions;
+    std::map<std::string, llvm::StructType*> struct_types;
+
+    llvm::StructType* stack_type;
+    llvm::StructType* gmachine_type;
+    llvm::PointerType* stack_ptr_type;
+    llvm::PointerType* gmachine_ptr_type;
+    llvm::PointerType* node_ptr_type;
+    llvm::IntegerType* tag_type;
+    llvm::FunctionType* function_type;
+
+    llvm_context()
+        : builder(ctx), module("bloglang", ctx) {
+        create_types();
+        create_functions();
+    }
+
+    void create_types();
+    void create_functions();
+
+    llvm::ConstantInt* create_i8(int8_t);
+    llvm::ConstantInt* create_i32(int32_t);
+    llvm::ConstantInt* create_size(size_t);
+
+    llvm::Value* create_pop(llvm::Function*);
+    llvm::Value* create_peek(llvm::Function*, llvm::Value*);
+    void create_push(llvm::Function*, llvm::Value*);
+    void create_popn(llvm::Function*, llvm::Value*);
+    void create_update(llvm::Function*, llvm::Value*);
+    void create_pack(llvm::Function*, llvm::Value*, llvm::Value*);
+    void create_split(llvm::Function*, llvm::Value*);
+    void create_slide(llvm::Function*, llvm::Value*);
+    void create_alloc(llvm::Function*, llvm::Value*);
+    llvm::Value* create_track(llvm::Function*, llvm::Value*);
+
+    void create_unwind(llvm::Function*);
+
+    llvm::Value* unwrap_gmachine_stack_ptr(llvm::Value*);
+
+    llvm::Value* unwrap_num(llvm::Value*);
+    llvm::Value* create_num(llvm::Function*, llvm::Value*);
+
+    llvm::Value* unwrap_data_tag(llvm::Value*);
+
+    llvm::Value* create_global(llvm::Function*, llvm::Value*, llvm::Value*);
+
+    llvm::Value* create_app(llvm::Function*, llvm::Value*, llvm::Value*);
+
+    llvm::Function* create_custom_function(std::string name, int32_t arity);
+};

code/compiler/10/main.cpp

@@ -0,0 +1,204 @@
+#include "ast.hpp"
+#include <iostream>
+#include "binop.hpp"
+#include "definition.hpp"
+#include "graph.hpp"
+#include "instruction.hpp"
+#include "llvm_context.hpp"
+#include "parser.hpp"
+#include "error.hpp"
+#include "type.hpp"
+#include "llvm/IR/LegacyPassManager.h"
+#include "llvm/IR/Verifier.h"
+#include "llvm/Support/TargetSelect.h"
+#include "llvm/Support/TargetRegistry.h"
+#include "llvm/Support/raw_ostream.h"
+#include "llvm/Support/FileSystem.h"
+#include "llvm/Target/TargetOptions.h"
+#include "llvm/Target/TargetMachine.h"
+
+void yy::parser::error(const std::string& msg) {
+    std::cout << "An error occured: " << msg << std::endl;
+}
+
+extern std::map<std::string, definition_data_ptr> defs_data;
+extern std::map<std::string, definition_defn_ptr> defs_defn;
+
+void typecheck_program(
+        const std::map<std::string, definition_data_ptr>& defs_data,
+        const std::map<std::string, definition_defn_ptr>& defs_defn,
+        type_mgr& mgr, type_env_ptr& env) {
+    type_ptr int_type = type_ptr(new type_base("Int")); 
+    env->bind_type("Int", int_type);
+
+    type_ptr binop_type = type_ptr(new type_arr(
+                int_type,
+                type_ptr(new type_arr(int_type, int_type))));
+    env->bind("+", binop_type);
+    env->bind("-", binop_type);
+    env->bind("*", binop_type);
+    env->bind("/", binop_type);
+
+    for(auto& def_data : defs_data) {
+        def_data.second->insert_types(mgr, env);
+    }
+    for(auto& def_data : defs_data) {
+        def_data.second->insert_constructors();
+    }
+
+    function_graph dependency_graph;
+
+    for(auto& def_defn : defs_defn) {
+        def_defn.second->find_free(mgr, env);
+        dependency_graph.add_function(def_defn.second->name);
+
+        for(auto& dependency : def_defn.second->free_variables) {
+            if(defs_defn.find(dependency) == defs_defn.end())
+                throw 0;
+            dependency_graph.add_edge(def_defn.second->name, dependency);
+        }
+    }
+
+    std::vector<group_ptr> groups = dependency_graph.compute_order();
+    for(auto it = groups.rbegin(); it != groups.rend(); it++) {
+        auto& group = *it;
+        for(auto& def_defnn_name : group->members) {
+            auto& def_defn = defs_defn.find(def_defnn_name)->second;
+            def_defn->insert_types(mgr);
+        }
+        for(auto& def_defnn_name : group->members) {
+            auto& def_defn = defs_defn.find(def_defnn_name)->second;
+            def_defn->typecheck(mgr);
+        }
+        for(auto& def_defnn_name : group->members) {
+            env->generalize(def_defnn_name, mgr);
+        }
+    }
+
+    for(auto& pair : env->names) {
+        std::cout << pair.first << ": ";
+        pair.second->print(mgr, std::cout);
+        std::cout << std::endl;
+    }
+}
+
+void compile_program(const std::map<std::string, definition_defn_ptr>& defs_defn) {
+    for(auto& def_defn : defs_defn) {
+        def_defn.second->compile();
+
+        for(auto& instruction : def_defn.second->instructions) {
+            instruction->print(0, std::cout);
+        }
+        std::cout << std::endl;
+    }
+}
+
+void gen_llvm_internal_op(llvm_context& ctx, binop op) {
+    auto new_function = ctx.create_custom_function(op_action(op), 2);
+    std::vector<instruction_ptr> instructions;
+    instructions.push_back(instruction_ptr(new instruction_push(1)));
+    instructions.push_back(instruction_ptr(new instruction_eval()));
+    instructions.push_back(instruction_ptr(new instruction_push(1)));
+    instructions.push_back(instruction_ptr(new instruction_eval()));
+    instructions.push_back(instruction_ptr(new instruction_binop(op)));
+    instructions.push_back(instruction_ptr(new instruction_update(2)));
+    instructions.push_back(instruction_ptr(new instruction_pop(2)));
+    ctx.builder.SetInsertPoint(&new_function->getEntryBlock());
+    for(auto& instruction : instructions) {
+        instruction->gen_llvm(ctx, new_function);
+    }
+    ctx.builder.CreateRetVoid();
+}
+
+void output_llvm(llvm_context& ctx, const std::string& filename) {
+    std::string targetTriple = llvm::sys::getDefaultTargetTriple();
+
+    llvm::InitializeNativeTarget();
+    llvm::InitializeNativeTargetAsmParser();
+    llvm::InitializeNativeTargetAsmPrinter();
+
+    std::string error;
+    const llvm::Target* target =
+        llvm::TargetRegistry::lookupTarget(targetTriple, error);
+    if (!target) {
+        std::cerr << error << std::endl;
+    } else {
+        std::string cpu = "generic";
+        std::string features = "";
+        llvm::TargetOptions options;
+        llvm::TargetMachine* targetMachine =
+            target->createTargetMachine(targetTriple, cpu, features,
+                    options, llvm::Optional<llvm::Reloc::Model>());
+
+        ctx.module.setDataLayout(targetMachine->createDataLayout());
+        ctx.module.setTargetTriple(targetTriple);
+
+        std::error_code ec;
+        llvm::raw_fd_ostream file(filename, ec, llvm::sys::fs::F_None);
+        if (ec) {
+            throw 0;
+        } else {
+            llvm::TargetMachine::CodeGenFileType type = llvm::TargetMachine::CGFT_ObjectFile;
+            llvm::legacy::PassManager pm;
+            if (targetMachine->addPassesToEmitFile(pm, file, NULL, type)) {
+                throw 0;
+            } else {
+                pm.run(ctx.module);
+                file.close();
+            }
+        }
+    }
+}
+
+void gen_llvm(
+        const std::map<std::string, definition_data_ptr>& defs_data,
+        const std::map<std::string, definition_defn_ptr>& defs_defn) {
+    llvm_context ctx;
+    gen_llvm_internal_op(ctx, PLUS);
+    gen_llvm_internal_op(ctx, MINUS);
+    gen_llvm_internal_op(ctx, TIMES);
+    gen_llvm_internal_op(ctx, DIVIDE);
+
+    for(auto& def_data : defs_data) {
+        def_data.second->generate_llvm(ctx);
+    }
+    for(auto& def_defn : defs_defn) {
+        def_defn.second->declare_llvm(ctx);
+    }
+    for(auto& def_defn : defs_defn) {
+        def_defn.second->generate_llvm(ctx);
+    }
+
+    ctx.module.print(llvm::outs(), nullptr);
+    output_llvm(ctx, "program.o");
+}
+
+int main() {
+    yy::parser parser;
+    type_mgr mgr;
+    type_env_ptr env(new type_env);
+
+    parser.parse();
+    for(auto& def_defn : defs_defn) {
+        std::cout << def_defn.second->name;
+        for(auto& param : def_defn.second->params) std::cout << " " << param;
+        std::cout << ":" << std::endl;
+
+        def_defn.second->body->print(1, std::cout);
+    }
+    try {
+        typecheck_program(defs_data, defs_defn, mgr, env);
+        compile_program(defs_defn);
+        gen_llvm(defs_data, defs_defn);
+    } catch(unification_error& err) {
+        std::cout << "failed to unify types: " << std::endl;
+        std::cout << "  (1) \033[34m";
+        err.left->print(mgr, std::cout);
+        std::cout << "\033[0m" << std::endl;
+        std::cout << "  (2) \033[32m";
+        err.right->print(mgr, std::cout);
+        std::cout << "\033[0m" << std::endl;
+    } catch(type_error& err) {
+        std::cout << "failed to type check program: " << err.description << std::endl;
+    }
+}

code/compiler/10/parser.y

@@ -0,0 +1,144 @@
+%{
+#include <string>
+#include <iostream>
+#include <map>
+#include "ast.hpp"
+#include "definition.hpp"
+#include "parser.hpp"
+
+std::map<std::string, definition_data_ptr> defs_data;
+std::map<std::string, definition_defn_ptr> defs_defn;
+
+extern yy::parser::symbol_type yylex();
+
+%}
+
+%token PLUS
+%token TIMES
+%token MINUS
+%token DIVIDE
+%token <int> INT
+%token DEFN
+%token DATA
+%token CASE
+%token OF
+%token OCURLY
+%token CCURLY
+%token OPAREN
+%token CPAREN
+%token COMMA
+%token ARROW
+%token EQUAL
+%token <std::string> LID
+%token <std::string> UID
+
+%language "c++"
+%define api.value.type variant
+%define api.token.constructor
+
+%type <std::vector<std::string>> lowercaseParams uppercaseParams
+%type <std::vector<branch_ptr>> branches
+%type <std::vector<constructor_ptr>> constructors
+%type <ast_ptr> aAdd aMul case app appBase
+%type <definition_data_ptr> data 
+%type <definition_defn_ptr> defn
+%type <branch_ptr> branch
+%type <pattern_ptr> pattern
+%type <constructor_ptr> constructor
+
+%start program
+
+%%
+
+program
+    : definitions { }
+    ;
+
+definitions
+    : definitions definition { }
+    | definition { }
+    ;
+
+definition
+    : defn { auto name = $1->name; defs_defn[name] = std::move($1); }
+    | data { auto name = $1->name; defs_data[name] = std::move($1); }
+    ;
+
+defn
+    : DEFN LID lowercaseParams EQUAL OCURLY aAdd CCURLY
+        { $$ = definition_defn_ptr(
+            new definition_defn(std::move($2), std::move($3), std::move($6))); }
+    ;
+
+lowercaseParams
+    : %empty { $$ = std::vector<std::string>(); }
+    | lowercaseParams LID { $$ = std::move($1); $$.push_back(std::move($2)); }
+    ;
+
+uppercaseParams
+    : %empty { $$ = std::vector<std::string>(); }
+    | uppercaseParams UID { $$ = std::move($1); $$.push_back(std::move($2)); }
+    ;
+
+aAdd
+    : aAdd PLUS aMul { $$ = ast_ptr(new ast_binop(PLUS, std::move($1), std::move($3))); }
+    | aAdd MINUS aMul { $$ = ast_ptr(new ast_binop(MINUS, std::move($1), std::move($3))); }
+    | aMul { $$ = std::move($1); }
+    ;
+
+aMul
+    : aMul TIMES app { $$ = ast_ptr(new ast_binop(TIMES, std::move($1), std::move($3))); }
+    | aMul DIVIDE app { $$ = ast_ptr(new ast_binop(DIVIDE, std::move($1), std::move($3))); }
+    | app { $$ = std::move($1); }
+    ;
+
+app
+    : app appBase { $$ = ast_ptr(new ast_app(std::move($1), std::move($2))); }
+    | appBase { $$ = std::move($1); }
+    ;
+
+appBase
+    : INT { $$ = ast_ptr(new ast_int($1)); }
+    | LID { $$ = ast_ptr(new ast_lid(std::move($1))); }
+    | UID { $$ = ast_ptr(new ast_uid(std::move($1))); }
+    | OPAREN aAdd CPAREN { $$ = std::move($2); }
+    | case { $$ = std::move($1); }
+    ;
+
+case
+    : CASE aAdd OF OCURLY branches CCURLY 
+        { $$ = ast_ptr(new ast_case(std::move($2), std::move($5))); }
+    ;
+
+branches
+    : branches branch { $$ = std::move($1); $$.push_back(std::move($2)); }
+    | branch { $$ = std::vector<branch_ptr>(); $$.push_back(std::move($1));}
+    ;
+
+branch
+    : pattern ARROW OCURLY aAdd CCURLY
+        { $$ = branch_ptr(new branch(std::move($1), std::move($4))); }
+    ;
+
+pattern
+    : LID { $$ = pattern_ptr(new pattern_var(std::move($1))); }
+    | UID lowercaseParams
+        { $$ = pattern_ptr(new pattern_constr(std::move($1), std::move($2))); }
+    ;
+
+data
+    : DATA UID EQUAL OCURLY constructors CCURLY
+        { $$ = definition_data_ptr(new definition_data(std::move($2), std::move($5))); }
+    ;
+
+constructors
+    : constructors COMMA constructor { $$ = std::move($1); $$.push_back(std::move($3)); }
+    | constructor
+        { $$ = std::vector<constructor_ptr>(); $$.push_back(std::move($1)); }
+    ;
+
+constructor
+    : UID uppercaseParams
+        { $$ = constructor_ptr(new constructor(std::move($1), std::move($2))); }
+    ;
+

code/compiler/10/runtime.c

@@ -0,0 +1,269 @@
+#include <stdint.h>
+#include <assert.h>
+#include <memory.h>
+#include <stdio.h>
+#include "runtime.h"
+
+struct node_base* alloc_node() {
+    struct node_base* new_node = malloc(sizeof(struct node_app));
+    new_node->gc_next = NULL;
+    new_node->gc_reachable = 0;
+    assert(new_node != NULL);
+    return new_node;
+}
+
+struct node_app* alloc_app(struct node_base* l, struct node_base* r) {
+    struct node_app* node = (struct node_app*) alloc_node();
+    node->base.tag = NODE_APP;
+    node->left = l;
+    node->right = r;
+    return node;
+}
+
+struct node_num* alloc_num(int32_t n) {
+    struct node_num* node = (struct node_num*) alloc_node();
+    node->base.tag = NODE_NUM;
+    node->value = n;
+    return node;
+}
+
+struct node_global* alloc_global(void (*f)(struct gmachine*), int32_t a) {
+    struct node_global* node = (struct node_global*) alloc_node();
+    node->base.tag = NODE_GLOBAL;
+    node->arity = a;
+    node->function = f;
+    return node;
+}
+
+struct node_ind* alloc_ind(struct node_base* n) {
+    struct node_ind* node = (struct node_ind*) alloc_node();
+    node->base.tag = NODE_IND;
+    node->next = n;
+    return node;
+}
+
+void free_node_direct(struct node_base* n) {
+    if(n->tag == NODE_DATA) {
+        free(((struct node_data*) n)->array);
+    }
+}
+
+void gc_visit_node(struct node_base* n) {
+    if(n->gc_reachable) return;
+    n->gc_reachable = 1;
+
+    if(n->tag == NODE_APP) {
+        struct node_app* app = (struct node_app*) n;
+        gc_visit_node(app->left);
+        gc_visit_node(app->right);
+    } if(n->tag == NODE_IND) {
+        struct node_ind* ind = (struct node_ind*) n;
+        gc_visit_node(ind->next);
+    } if(n->tag == NODE_DATA) {
+        struct node_data* data = (struct node_data*) n;
+        struct node_base** to_visit = data->array;
+        while(*to_visit) {
+            gc_visit_node(*to_visit);
+            to_visit++;
+        }
+    }
+}
+
+void stack_init(struct stack* s) {
+    s->size = 4;
+    s->count = 0;
+    s->data = malloc(sizeof(*s->data) * s->size);
+    assert(s->data != NULL);
+}
+
+void stack_free(struct stack* s) {
+    free(s->data);
+}
+
+void stack_push(struct stack* s, struct node_base* n) {
+    while(s->count >= s->size) {
+        s->data = realloc(s->data, sizeof(*s->data) * (s->size *= 2));
+        assert(s->data != NULL);
+    }
+    s->data[s->count++] = n;
+}
+
+struct node_base* stack_pop(struct stack* s) {
+    assert(s->count > 0);
+    return s->data[--s->count];
+}
+
+struct node_base* stack_peek(struct stack* s, size_t o) {
+    assert(s->count > o);
+    return s->data[s->count - o - 1];
+}
+
+void stack_popn(struct stack* s, size_t n) {
+    assert(s->count >= n);
+    s->count -= n;
+}
+
+void gmachine_init(struct gmachine* g) {
+    stack_init(&g->stack);
+    g->gc_nodes = NULL;
+    g->gc_node_count = 0;
+    g->gc_node_threshold = 128;
+}
+
+void gmachine_free(struct gmachine* g) {
+    stack_free(&g->stack);
+    struct node_base* to_free = g->gc_nodes;
+    struct node_base* next;
+
+    while(to_free) {
+        next = to_free->gc_next;
+        free_node_direct(to_free);
+        free(to_free);
+        to_free = next;
+    }
+}
+
+void gmachine_slide(struct gmachine* g, size_t n) {
+    assert(g->stack.count > n);
+    g->stack.data[g->stack.count - n - 1] = g->stack.data[g->stack.count - 1];
+    g->stack.count -= n;
+}
+
+void gmachine_update(struct gmachine* g, size_t o) {
+    assert(g->stack.count > o + 1);
+    struct node_ind* ind =
+        (struct node_ind*) g->stack.data[g->stack.count - o - 2];
+    ind->base.tag = NODE_IND;
+    ind->next = g->stack.data[g->stack.count -= 1];
+}
+
+void gmachine_alloc(struct gmachine* g, size_t o) {
+    while(o--) {
+        stack_push(&g->stack,
+                gmachine_track(g, (struct node_base*) alloc_ind(NULL)));
+    }
+}
+
+void gmachine_pack(struct gmachine* g, size_t n, int8_t t) {
+    assert(g->stack.count >= n);
+
+    struct node_base** data = malloc(sizeof(*data) * (n + 1));
+    assert(data != NULL);
+    memcpy(data, &g->stack.data[g->stack.count - n], n * sizeof(*data));
+    data[n] = NULL;
+
+    struct node_data* new_node = (struct node_data*) alloc_node();
+    new_node->array = data;
+    new_node->base.tag = NODE_DATA;
+    new_node->tag = t;
+
+    stack_popn(&g->stack, n);
+    stack_push(&g->stack, gmachine_track(g, (struct node_base*) new_node));
+}
+
+void gmachine_split(struct gmachine* g, size_t n) {
+    struct node_data* node = (struct node_data*) stack_pop(&g->stack);
+    for(size_t i = 0; i < n; i++) {
+        stack_push(&g->stack, node->array[i]);
+    }
+}
+
+struct node_base* gmachine_track(struct gmachine* g, struct node_base* b) {
+    g->gc_node_count++;
+    b->gc_next = g->gc_nodes;
+    g->gc_nodes = b;
+
+    if(g->gc_node_count >= g->gc_node_threshold) {
+        uint64_t nodes_before = g->gc_node_count;
+        gc_visit_node(b);
+        gmachine_gc(g);
+        g->gc_node_threshold = g->gc_node_count * 2;
+    }
+
+    return b;
+}
+
+void gmachine_gc(struct gmachine* g) {
+    for(size_t i = 0; i < g->stack.count; i++) {
+        gc_visit_node(g->stack.data[i]);
+    }
+
+    struct node_base** head_ptr = &g->gc_nodes;
+    while(*head_ptr) {
+        if((*head_ptr)->gc_reachable) {
+            (*head_ptr)->gc_reachable = 0;
+            head_ptr = &(*head_ptr)->gc_next;
+        } else {
+            struct node_base* to_free = *head_ptr;
+            *head_ptr = to_free->gc_next;
+            free_node_direct(to_free);
+            free(to_free);
+            g->gc_node_count--;
+        }
+    }
+}
+
+void unwind(struct gmachine* g) {
+    struct stack* s = &g->stack;
+
+    while(1) {
+        struct node_base* peek = stack_peek(s, 0);
+        if(peek->tag == NODE_APP) {
+            struct node_app* n = (struct node_app*) peek;
+            stack_push(s, n->left);
+        } else if(peek->tag == NODE_GLOBAL) {
+            struct node_global* n = (struct node_global*) peek;
+            assert(s->count > n->arity);
+
+            for(size_t i = 1; i <= n->arity; i++) {
+                s->data[s->count - i]
+                    = ((struct node_app*) s->data[s->count - i - 1])->right;
+            }
+
+            n->function(g);
+        } else if(peek->tag == NODE_IND) {
+            struct node_ind* n = (struct node_ind*) peek;
+            stack_pop(s);
+            stack_push(s, n->next);
+        } else {
+            break;
+        }
+    }
+}
+
+extern void f_main(struct gmachine* s);
+
+void print_node(struct node_base* n) {
+    if(n->tag == NODE_APP) {
+        struct node_app* app = (struct node_app*) n;
+        print_node(app->left);
+        putchar(' ');
+        print_node(app->right);
+    } else if(n->tag == NODE_DATA) {
+        printf("(Packed)");
+    } else if(n->tag == NODE_GLOBAL) {
+        struct node_global* global = (struct node_global*) n;
+        printf("(Global: %p)", global->function);
+    } else if(n->tag == NODE_IND) {
+        print_node(((struct node_ind*) n)->next);
+    } else if(n->tag == NODE_NUM) {
+        struct node_num* num = (struct node_num*) n;
+        printf("%d", num->value);
+    }
+}
+
+int main(int argc, char** argv) {
+    struct gmachine gmachine;
+    struct node_global* first_node = alloc_global(f_main, 0);
+    struct node_base* result;
+
+    gmachine_init(&gmachine);
+    gmachine_track(&gmachine, (struct node_base*) first_node);
+    stack_push(&gmachine.stack, (struct node_base*) first_node);
+    unwind(&gmachine);
+    result = stack_pop(&gmachine.stack);
+    printf("Result: ");
+    print_node(result);
+    putchar('\n');
+    gmachine_free(&gmachine);
+}

code/compiler/10/runtime.h

@@ -0,0 +1,84 @@
+#pragma once
+#include <stdlib.h>
+
+struct gmachine;
+
+enum node_tag {
+    NODE_APP,
+    NODE_NUM,
+    NODE_GLOBAL,
+    NODE_IND,
+    NODE_DATA
+};
+
+struct node_base {
+    enum node_tag tag;
+    int8_t gc_reachable;
+    struct node_base* gc_next;
+};
+
+struct node_app {
+    struct node_base base;
+    struct node_base* left;
+    struct node_base* right;
+};
+
+struct node_num {
+    struct node_base base;
+    int32_t value;
+};
+
+struct node_global {
+    struct node_base base;
+    int32_t arity;
+    void (*function)(struct gmachine*);
+};
+
+struct node_ind {
+    struct node_base base;
+    struct node_base* next;
+};
+
+struct node_data {
+    struct node_base base;
+    int8_t tag;
+    struct node_base** array;
+};
+
+struct node_base* alloc_node();
+struct node_app* alloc_app(struct node_base* l, struct node_base* r);
+struct node_num* alloc_num(int32_t n);
+struct node_global* alloc_global(void (*f)(struct gmachine*), int32_t a);
+struct node_ind* alloc_ind(struct node_base* n);
+void free_node_direct(struct node_base*);
+void gc_visit_node(struct node_base*);
+
+struct stack {
+    size_t size;
+    size_t count;
+    struct node_base** data;
+};
+
+void stack_init(struct stack* s);
+void stack_free(struct stack* s);
+void stack_push(struct stack* s, struct node_base* n);
+struct node_base* stack_pop(struct stack* s);
+struct node_base* stack_peek(struct stack* s, size_t o);
+void stack_popn(struct stack* s, size_t n);
+
+struct gmachine {
+    struct stack stack;
+    struct node_base* gc_nodes;
+    int64_t gc_node_count;
+    int64_t gc_node_threshold;
+};
+
+void gmachine_init(struct gmachine* g);
+void gmachine_free(struct gmachine* g);
+void gmachine_slide(struct gmachine* g, size_t n);
+void gmachine_update(struct gmachine* g, size_t o);
+void gmachine_alloc(struct gmachine* g, size_t o);
+void gmachine_pack(struct gmachine* g, size_t n, int8_t t);
+void gmachine_split(struct gmachine* g, size_t n);
+struct node_base* gmachine_track(struct gmachine* g, struct node_base* b);
+void gmachine_gc(struct gmachine* g);

code/compiler/10/scanner.l

@@ -0,0 +1,35 @@
+%option noyywrap
+
+%{
+#include <iostream>
+#include "ast.hpp"
+#include "definition.hpp"
+#include "parser.hpp"
+
+#define YY_DECL yy::parser::symbol_type yylex()
+
+%}
+
+%%
+
+[ \n]+ {}
+\+ { return yy::parser::make_PLUS(); }
+\* { return yy::parser::make_TIMES(); }
+- { return yy::parser::make_MINUS(); }
+\/ { return yy::parser::make_DIVIDE(); }
+[0-9]+ { return yy::parser::make_INT(atoi(yytext)); }
+defn { return yy::parser::make_DEFN(); }
+data { return yy::parser::make_DATA(); }
+case { return yy::parser::make_CASE(); }
+of { return yy::parser::make_OF(); }
+\{ { return yy::parser::make_OCURLY(); }
+\} { return yy::parser::make_CCURLY(); }
+\( { return yy::parser::make_OPAREN(); }
+\) { return yy::parser::make_CPAREN(); }
+,  { return yy::parser::make_COMMA(); }
+-> { return yy::parser::make_ARROW(); }
+= { return yy::parser::make_EQUAL(); }
+[a-z][a-zA-Z]* { return yy::parser::make_LID(std::string(yytext)); }
+[A-Z][a-zA-Z]* { return yy::parser::make_UID(std::string(yytext)); }
+
+%%

code/compiler/10/type.cpp

@@ -0,0 +1,148 @@
+#include "type.hpp"
+#include <ostream>
+#include <sstream>
+#include <algorithm>
+#include "error.hpp"
+
+void type_scheme::print(const type_mgr& mgr, std::ostream& to) const {
+    if(forall.size() != 0) {
+        to << "forall ";
+        for(auto& var : forall) {
+            to << var << " ";
+        }
+        to << ". ";
+    }
+    monotype->print(mgr, to);
+}
+
+type_ptr substitute(const type_mgr& mgr, const std::map<std::string, type_ptr>& subst, const type_ptr& t) {
+    type_var* var;
+    type_ptr resolved = mgr.resolve(t, var);
+    if(var) {
+        auto subst_it = subst.find(var->name);
+        if(subst_it == subst.end()) return resolved;
+        return subst_it->second;
+    } else if(type_arr* arr = dynamic_cast<type_arr*>(t.get())) {
+        auto left_result = substitute(mgr, subst, arr->left);
+        auto right_result = substitute(mgr, subst, arr->right);
+        if(left_result == arr->left && right_result == arr->right) return t;
+        return type_ptr(new type_arr(left_result, right_result));
+    }
+    return t;
+}
+
+type_ptr type_scheme::instantiate(type_mgr& mgr) const {
+    if(forall.size() == 0) return monotype;
+    std::map<std::string, type_ptr> subst;
+    for(auto& var : forall) {
+        subst[var] = mgr.new_type();
+    }
+    return substitute(mgr, subst, monotype);
+}
+
+void type_var::print(const type_mgr& mgr, std::ostream& to) const {
+    auto it = mgr.types.find(name);
+    if(it != mgr.types.end()) {
+        it->second->print(mgr, to);
+    } else {
+        to << name;
+    }
+}
+
+void type_base::print(const type_mgr& mgr, std::ostream& to) const {
+    to << name;
+}
+
+void type_arr::print(const type_mgr& mgr, std::ostream& to) const {
+    left->print(mgr, to);
+    to << " -> (";
+    right->print(mgr, to);
+    to << ")";
+}
+
+std::string type_mgr::new_type_name() {
+    int temp = last_id++;
+    std::string str = "";
+
+    while(temp != -1) {
+        str += (char) ('a' + (temp % 26));
+        temp = temp / 26 - 1;
+    }
+
+    std::reverse(str.begin(), str.end());
+    return str;
+}
+
+type_ptr type_mgr::new_type() {
+    return type_ptr(new type_var(new_type_name()));
+}
+
+type_ptr type_mgr::new_arrow_type() {
+    return type_ptr(new type_arr(new_type(), new_type()));
+}
+
+type_ptr type_mgr::resolve(type_ptr t, type_var*& var) const {
+    type_var* cast;
+
+    var = nullptr;
+    while((cast = dynamic_cast<type_var*>(t.get()))) {
+        auto it = types.find(cast->name);
+
+        if(it == types.end()) {
+            var = cast;
+            break;
+        }
+        t = it->second;
+    }
+
+    return t;
+}
+
+void type_mgr::unify(type_ptr l, type_ptr r) {
+    type_var* lvar;
+    type_var* rvar;
+    type_arr* larr;
+    type_arr* rarr;
+    type_base* lid;
+    type_base* rid;
+
+    l = resolve(l, lvar);
+    r = resolve(r, rvar);
+
+    if(lvar) {
+        bind(lvar->name, r);
+        return;
+    } else if(rvar) {
+        bind(rvar->name, l);
+        return;
+    } else if((larr = dynamic_cast<type_arr*>(l.get())) &&
+            (rarr = dynamic_cast<type_arr*>(r.get()))) {
+        unify(larr->left, rarr->left);
+        unify(larr->right, rarr->right);
+        return;
+    } else if((lid = dynamic_cast<type_base*>(l.get())) &&
+            (rid = dynamic_cast<type_base*>(r.get()))) {
+        if(lid->name == rid->name) return;
+    }
+
+    throw unification_error(l, r);
+}
+
+void type_mgr::bind(const std::string& s, type_ptr t) {
+    type_var* other = dynamic_cast<type_var*>(t.get());
+    
+    if(other && other->name == s) return;
+    types[s] = t;
+}
+
+void type_mgr::find_free(const type_ptr& t, std::set<std::string>& into) const {
+    type_var* var;
+    type_ptr resolved = resolve(t, var);
+
+    if(var) {
+        into.insert(var->name);
+    } else if(type_arr* arr = dynamic_cast<type_arr*>(resolved.get())) {
+        find_free(arr->left, into);
+        find_free(arr->right, into);
+    }
+}

code/compiler/10/type.hpp

@@ -0,0 +1,81 @@
+#pragma once
+#include <memory>
+#include <map>
+#include <string>
+#include <vector>
+#include <set>
+
+struct type_mgr;
+
+struct type {
+    virtual ~type() = default;
+
+    virtual void print(const type_mgr& mgr, std::ostream& to) const = 0;
+};
+
+using type_ptr = std::shared_ptr<type>;
+
+struct type_scheme {
+    std::vector<std::string> forall;
+    type_ptr monotype;
+
+    type_scheme(type_ptr type) : forall(), monotype(std::move(type)) {}
+
+    void print(const type_mgr& mgr, std::ostream& to) const;
+    type_ptr instantiate(type_mgr& mgr) const;
+};
+
+using type_scheme_ptr = std::shared_ptr<type_scheme>;
+
+struct type_var : public type {
+    std::string name;
+
+    type_var(std::string n)
+        : name(std::move(n)) {}
+
+    void print(const type_mgr& mgr, std::ostream& to) const;
+};
+
+struct type_base : public type {
+    std::string name;
+
+    type_base(std::string n) 
+        : name(std::move(n)) {}
+
+    void print(const type_mgr& mgr, std::ostream& to) const;
+};
+
+struct type_data : public type_base {
+    struct constructor {
+        int tag;
+    };
+
+    std::map<std::string, constructor> constructors;
+
+    type_data(std::string n)
+        : type_base(std::move(n)) {}
+};
+
+struct type_arr : public type {
+    type_ptr left;
+    type_ptr right;
+
+    type_arr(type_ptr l, type_ptr r)
+        : left(std::move(l)), right(std::move(r)) {}
+
+    void print(const type_mgr& mgr, std::ostream& to) const;
+};
+
+struct type_mgr {
+    int last_id = 0;
+    std::map<std::string, type_ptr> types;
+
+    std::string new_type_name();
+    type_ptr new_type();
+    type_ptr new_arrow_type();
+
+    void unify(type_ptr l, type_ptr r);
+    type_ptr resolve(type_ptr t, type_var*& var) const;
+    void bind(const std::string& s, type_ptr t);
+    void find_free(const type_ptr& t, std::set<std::string>& into) const;
+};

code/compiler/10/type_env.cpp

@@ -0,0 +1,45 @@
+#include "type_env.hpp"
+#include "type.hpp"
+
+type_scheme_ptr type_env::lookup(const std::string& name) const {
+    auto it = names.find(name);
+    if(it != names.end()) return it->second;
+    if(parent) return parent->lookup(name);
+    return nullptr;
+}
+
+type_ptr type_env::lookup_type(const std::string& name) const {
+    auto it = type_names.find(name);
+    if(it != type_names.end()) return it->second;
+    if(parent) return parent->lookup_type(name);
+    return nullptr;
+}
+
+void type_env::bind(const std::string& name, type_ptr t) {
+    names[name] = type_scheme_ptr(new type_scheme(t));
+}
+
+void type_env::bind(const std::string& name, type_scheme_ptr t) {
+    names[name] = t;
+}
+
+void type_env::bind_type(const std::string& type_name, type_ptr t) {
+    if(lookup_type(type_name) != nullptr) throw 0;
+    type_names[type_name] = t;
+}
+
+void type_env::generalize(const std::string& name, type_mgr& mgr) {
+    auto names_it = names.find(name);
+    if(names_it == names.end()) throw 0;
+    if(names_it->second->forall.size() > 0) throw 0;
+
+    std::set<std::string> free_variables;
+    mgr.find_free(names_it->second->monotype, free_variables);
+    for(auto& free : free_variables) {
+        names_it->second->forall.push_back(free);
+    }
+}
+
+type_env_ptr type_scope(type_env_ptr parent) {
+    return type_env_ptr(new type_env(std::move(parent)));
+}

code/compiler/10/type_env.hpp

@@ -0,0 +1,26 @@
+#pragma once
+#include <map>
+#include <string>
+#include "type.hpp"
+
+struct type_env;
+using type_env_ptr = std::shared_ptr<type_env>;
+
+struct type_env {
+    type_env_ptr parent;
+    std::map<std::string, type_scheme_ptr> names;
+    std::map<std::string, type_ptr> type_names;
+
+    type_env(type_env_ptr p) : parent(std::move(p)) {}
+    type_env() : type_env(nullptr) {}
+
+    type_scheme_ptr lookup(const std::string& name) const;
+    type_ptr lookup_type(const std::string& name) const;
+    void bind(const std::string& name, type_ptr t);
+    void bind(const std::string& name, type_scheme_ptr t);
+    void bind_type(const std::string& type_name, type_ptr t);
+    void generalize(const std::string& name, type_mgr& mgr);
+};
+
+
+type_env_ptr type_scope(type_env_ptr parent);

code/compiler/test.sh

@@ -0,0 +1,4 @@
+cd 10
+mkdir -p build && cd build
+cmake ..
+make -j8

code/cs325-langs/hws/hw1.txt

@@ -0,0 +1,119 @@
+CS 325-001, Analysis of Algorithms, Fall 2019
+HW1 - Python 3, qsort, BST, and qselect
+Due electronically on flip on Monday 9/30 at 11:59pm. 
+No late submission will be accepted.
+
+Need to submit on flip: report.txt, qsort.py, and qselect.py.
+qselect.py will be automatically graded for correctness (1%).
+
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw1 qselect.py qsort.py report.txt
+
+Note:
+
+1. You can ssh to flip machines from your own machine by:
+   $ ssh access.engr.oregonstate.edu
+
+2. You can add /nfs/farm/classes/eecs/fall2019/cs325-001/ to your $PATH:
+   $ export PATH=$PATH:/nfs/farm/classes/eecs/fall2019/cs325-001/
+   and add the above command to your ~/.bash_profile,
+   so that you don't need to type it every time.
+
+   (alternatively, you can use symbolic links or aliases to avoid typing the long path)
+
+3. You can choose to submit each file separately, or submit them together.
+
+Textbooks for References:
+[1] CLRS Ch. 9.2 and Ch. 12
+
+0. Q: What's the best-case, worst-case, and average-case time complexities of quicksort.
+   Briefly explain each case.
+
+1. [WILL BE GRADED] 
+   Quickselect with Randomized Pivot (CLRS Ch. 9.2).
+
+   >>> from qselect import *
+   >>> qselect(2, [3, 10, 4, 7, 19])
+   4
+   >>> qselect(4, [11, 2, 8, 3])
+   11
+
+   Q: What's the best-case, worst-case, and average-case time complexities? Briefly explain.
+
+   Filename: qselect.py
+
+
+2. Buggy Qsort Revisited
+
+   In the slides we showed a buggy version of qsort which is weird in an interesting way:
+   it actually returns a binary search tree for the given array, rooted at the pivot:
+
+   >>> from qsort import *
+   >>> tree = sort([4,2,6,3,5,7,1,9])
+   >>> tree
+   [[[[], 1, []], 2, [[], 3, []]], 4, [[[], 5, []], 6, [[], 7, [[], 9, []]]]]
+
+   which encodes a binary search tree:
+
+                      4
+                    /   \
+                  2       6
+                 / \     / \
+                1   3   5   7
+                             \
+                              9
+   
+   Now on top of that piece of code, add three functions: 
+   * sorted(t): returns the sorted order (infix traversal)
+   * search(t, x): returns whether x is in t
+   * insert(t, x): inserts x into t (in-place) if it is missing, otherwise does nothing.
+
+   >>> sorted(tree)
+   [1, 2, 3, 4, 5, 6, 7, 9]
+   >>> search(tree, 6)
+   True
+   >>> search(tree, 6.5)
+   False
+   >>> insert(tree, 6.5)
+   >>> tree
+   [[[[], 1, []], 2, [[], 3, []]], 4, [[[], 5, []], 6, [[[], 6.5, []], 7, [[], 9, []]]]]
+   >>> insert(tree, 3)
+   >>> tree
+   [[[[], 1, []], 2, [[], 3, []]], 4, [[[], 5, []], 6, [[[], 6.5, []], 7, [[], 9, []]]]]
+
+   Hint: both search and insert should depend on a helper function _search(tree, x) which 
+   returns the subtree (a list) rooted at x when x is found, or the [] where x should 
+   be inserted.
+
+   e.g., 
+   >>> tree = sort([4,2,6,3,5,7,1,9])        # starting from the initial tree
+   >>> _search(tree, 3)
+   [[], 3, []]
+   >>> _search(tree, 0)
+   []
+   >>> _search(tree, 6.5)
+   []
+   >>> _search(tree, 0) is _search(tree, 6.5)
+   False
+   >>> _search(tree, 0) == _search(tree, 6.5)
+   True
+   
+   Note the last two []'s are different nodes (with different memory addresses): 
+   the first one is the left child of 1, while the second one is the left child of 7
+   (so that insert is very easy).
+   
+   Filename: qsort.py
+   
+   Q: What are the time complexities for the operations implemented?
+
+Debriefing (required!): --------------------------
+
+1. Approximately how many hours did you spend on this assignment?
+2. Would you rate it as easy, moderate, or difficult?
+3. Did you work on it mostly alone, or mostly with other people?
+4. How deeply do you feel you understand the material it covers (0%–100%)? 
+5. Any other comments?
+
+This section is intended to help us calibrate the homework assignments. 
+Your answers to this section will *not* affect your grade; however, skipping it
+will certainly do.
+

code/cs325-langs/hws/hw10.txt

@@ -0,0 +1,170 @@
+CS 325, Algorithms (MS/MEng-level), Fall 2019
+
+HW10 - Challenge Problem - RNA Structure Prediction (6%)
+This problem combines dynamic programming and priority queues.
+
+Due Wednesday 12/4, 11:59pm.
+No late submission will be accepted.
+
+Include in your submission: report.txt, rna.py.
+Grading: 
+* report.txt -- 1%
+* 1-best structure -- 2%
+* number of structures -- 1%
+* k-best structures -- 2%
+
+Textbooks for References:
+[1] KT Ch. 6.5 (DP over intervals -- RNA structure)    
+[2] KT slides: DP I (RNA section)
+    http://www.cs.princeton.edu/~wayne/kleinberg-tardos/
+
+***Please analyze time/space complexities for each problem in report.txt.
+
+1. Given an RNA sequence, such as ACAGU, we can predict its secondary structure 
+   by tagging each nucleotide as (, ., or ). Each matching pair of () must be 
+   AU, GC, or GU (or their mirror symmetries: UA, CG, UG). 
+   We also assume pairs can _not_ cross each other. 
+   The following are valid structures for ACAGU:
+
+   ACAGU
+   .....
+   ...()
+   ..(.)
+   .(.).
+   (...)
+   ((.))    
+
+   We want to find the structure with the maximum number of matching pairs. 
+   In the above example, the last structure is optimal (2 pairs). 
+
+   >>> best("ACAGU")
+   (2, '((.))')
+
+   Tie-breaking: arbitrary. Don't worry as long as your structure
+   is one of the correct best structures.
+
+   some other cases (more cases at the bottom):
+
+   GCACG
+   (2, '().()')
+   UUCAGGA
+   (3, '(((.)))')
+   GUUAGAGUCU
+   (4, '(.()((.)))')
+   AUAACCUUAUAGGGCUCUG
+   (8, '.(((..)()()((()))))')
+   AACCGCUGUGUCAAGCCCAUCCUGCCUUGUU
+   (11, '(((.(..(.((.)((...().))()))))))')
+   GAUGCCGUGUAGUCCAAAGACUUCACCGUUGG
+   (14, '.()()(()(()())(((.((.)(.))()))))')
+   CAUCGGGGUCUGAGAUGGCCAUGAAGGGCACGUACUGUUU
+   (18, '(()())(((((.)))()(((())(.(.().()()))))))')
+   ACGGCCAGUAAAGGUCAUAUACGCGGAAUGACAGGUCUAUCUAC
+   (19, '.()(((.)(..))(((.()()(())))(((.)((())))))())')
+   AGGCAUCAAACCCUGCAUGGGAGCACCGCCACUGGCGAUUUUGGUA
+   (20, '.(()())...((((()()))((()(.()(((.)))()())))))()')
+
+2. Total number of all possible structures
+
+   >>> total("ACAGU")
+   6
+
+3. k-best structures: output the 1-best, 2nd-best, ... kth-best structures.
+
+   >>> kbest("ACAGU", 3)
+   [(2, '((.))'), (1, '(...)'), (1, '.(.).')]
+   
+   The list must be sorted. 
+   Tie-breaking: arbitrary.
+
+   In case the input k is bigger than the number of possible structures, output all.
+
+   Sanity check: kbest(s, 1)[0][0] == best(s)[0] for each RNA sequence s.
+
+All three functions should be in one file: rna.py.
+
+See more testcases at the end.
+   
+Debriefing (required!): --------------------------
+
+0. What's your name?
+1. Approximately how many hours did you spend on this assignment?
+2. Would you rate it as easy, moderate, or difficult?
+3. Did you work on it mostly alone, or mostly with other people?
+4. How deeply do you feel you understand the material it covers (0%-100%)? 
+5. Any other comments?
+
+This section is intended to help us calibrate the homework assignments. 
+Your answers to this section will *not* affect your grade; however, skipping it
+will certainly do.
+
+
+TESTCASES:
+
+for each sequence s, we list three lines:
+best(s)
+total(s)
+kbest(s, 10)
+
+
+
+ACAGU
+(2, '((.))')
+6
+[(2, '((.))'), (1, '.(.).'), (1, '..(.)'), (1, '...()'), (1, '(...)'), (0, '.....')]
+------
+AC
+(0, '..')
+1
+[(0, '..')]
+------
+GUAC
+(2, '(())')
+5
+[(2, '(())'), (1, '()..'), (1, '.().'), (1, '(..)'), (0, '....')]
+------
+GCACG
+(2, '().()')
+6
+[(2, '().()'), (1, '(..).'), (1, '()...'), (1, '.(..)'), (1, '...()'), (0, '.....')]
+------
+CCGG
+(2, '(())')
+6
+[(2, '(())'), (1, '(.).'), (1, '.().'), (1, '.(.)'), (1, '(..)'), (0, '....')]
+------
+CCCGGG
+(3, '((()))')
+20
+[(3, '((()))'), (2, '((.)).'), (2, '(.()).'), (2, '.(()).'), (2, '.(().)'), (2, '.((.))'), (2, '((.).)'), (2, '(.(.))'), (2, '(.().)'), (2, '((..))')]
+------
+UUCAGGA
+(3, '(((.)))')
+24
+[(3, '(((.)))'), (2, '((.).).'), (2, '((..)).'), (2, '(.(.)).'), (2, '((.))..'), (2, '.((.)).'), (2, '.((.).)'), (2, '.((..))'), (2, '((..).)'), (2, '((.)..)')]
+------
+AUAACCUA
+(2, '.((...))')
+19
+[(2, '((.)..).'), (2, '(()...).'), (2, '()(...).'), (2, '().(..).'), (2, '()....()'), (2, '.()(..).'), (2, '.()...()'), (2, '.(.)..()'), (2, '.((...))'), (2, '.(.(..))')]
+------
+UUGGACUUG
+(4, '(()((.)))')
+129
+[(4, '(())(.)()'), (4, '(()((.)))'), (3, '(().)..()'), (3, '(().).(.)'), (3, '(().)(..)'), (3, '((.))..()'), (3, '((.)).(.)'), (3, '((.))(..)'), (3, '(())(..).'), (3, '(())(.)..')]
+------
+UUUGGCACUA
+(4, '(.()()(.))')
+179
+[(4, '((()).).()'), (4, '((.)()).()'), (4, '(.()()).()'), (4, '.(()()).()'), (4, '.(()()(.))'), (4, '((()).(.))'), (4, '((.)()(.))'), (4, '((()())..)'), (4, '(.()()(.))'), (3, '((()).)...')]
+------
+GAUGCCGUGUAGUCCAAAGACUUC
+(11, '(((()()((()(.))))((.))))')
+2977987
+[(11, '(()())(((()().))(((.))))'), (11, '(()())(((()()).)(((.))))'), (11, '(()())(((()(.)))(((.))))'), (11, '(()()()((()(.)))(((.))))'), (11, '(((()()((()().)))((.))))'), (11, '(((()()((()(.))))((.))))'), (11, '(()()()((()()).)(((.))))'), (11, '(()()()((()().))(((.))))'), (11, '(((()()((()()).))((.))))'), (10, '(()()()((()().).)((.))).')]
+------
+AGGCAUCAAACCCUGCAUGGGAGCG
+(10, '.(()())...((((()()))).())')
+560580
+[(10, '.(()())...((((())())).)()'), (10, '.(()())...((((()()))).)()'), (10, '.(()())...(((()(()))).)()'), (10, '.(()())...(((()(()))).())'), (10, '.(()())...((((())())).())'), (10, '.(()())...((((()()))).())'), (9, '((.).)(...(.((()()))).)()'), (9, '((.).)(...(((.)(()))).)()'), (9, '((.).)(...(.(()(()))).)()'), (9, '((.).)(...((.(()()))).)()')]
+------

code/cs325-langs/hws/hw11.txt

@@ -0,0 +1,42 @@
+HW11 -- OPTIONAL (for your practice only -- solutions will be released on Tuesday)
+
+Edit Distance (see updated final review solutions)
+
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw11 edit.py
+
+Implement two functions:
+* distance1(s, t): Viterbi-style (either top-down or bottom-up)
+* distance2(s, t): Dijkstra-style (best-first)
+
+For Dijkstra, you can use either heapdict or heapq (see review problem 7).
+Given that this graph is extremely sparse (why?), heapq (ElogE) might be faster than heapdict (ElogV)
+because the latter has overhead for hash.
+
+They should return the same result (just return the edit distance).
+
+We have 10 testcases (listed below); the first 5 test distance1(), 
+and the second 5 test distance2() on the same 5 string pairs.
+
+My solutions (on flip2):
+Testing Case  1 (open)...	  0.001 s, Correct
+Testing Case  2 (open)...	  0.000 s, Correct
+Testing Case  3 (open)...	  0.012 s, Correct
+Testing Case  4 (open)...	  0.155 s, Correct
+Testing Case  5 (open)...	  0.112 s, Correct
+Testing Case  6 (hidden)...	  0.000 s, Correct
+Testing Case  7 (hidden)...	  0.000 s, Correct
+Testing Case  8 (hidden)...	  0.004 s, Correct
+Testing Case  9 (hidden)...	  0.009 s, Correct
+Testing Case 10 (hidden)...	  0.021 s, Correct
+Total Time: 0.316 s
+
+distance1("abcdefh", "abbcdfg") == 3
+distance1("pretty", "prettier") == 3
+distance1("aaaaaaadaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "aaaaaaaaaaaabaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxaaaaaaaaaaaaaaaaaaaaaa") == 5
+distance1('cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbxtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfjbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwy', 'cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasonrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwy') == 3
+distance1('cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpasdfkecyywrbvhlqgxzutdjfmvlhsezfbhbllmfhzlqlcwibubyyjupbwhztsxyksfthkptxqlmhivfjbgclhombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrttoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwydmbihjkvziitusmkjljrsbafytsinql', 'cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfjbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwydmbihjkvziitusmkjljrsbafytsinql') == 11
+distance2("abcdefh", "abbcdfg") == 3
+distance2("pretty", "prettier") == 3
+distance2("aaaaaaadaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "aaaaaaaaaaaabaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxaaaaaaaaaaaaaaaaaaaaaa") == 5
+distance2('cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbxtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfjbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwy', 'cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasonrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwy') == 3
+distance2('cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpasdfkecyywrbvhlqgxzutdjfmvlhsezfbhbllmfhzlqlcwibubyyjupbwhztsxyksfthkptxqlmhivfjbgclhombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrttoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwydmbihjkvziitusmkjljrsbafytsinql', 'cpuyedzrwcbritzclzhwwabmlyresvewkdxwkamyzbtwiqzvokqpkecyywrbvhlqgxzutdjfmvlhsezfbhfjbllmfhzlqlcwibubyyjupbwhztskyksfthkptxqlmhivfjbgclwsombvytdztapwpzmdqfwwrhqsgztobeuiatcwmrzfbwhfnpzzasomrhotoqiwvexlgxsnafiagfewmopdzwanxswfsmbxsmsczbwsgnwydmbihjkvziitusmkjljrsbafytsinql') == 11

code/cs325-langs/hws/hw2.txt

@@ -0,0 +1,80 @@
+CS 325-001, Analysis of Algorithms, Fall 2019
+HW2 - Divide-n-conquer: mergesort, number of inversions, longest path
+
+Due Monday Oct 7, 11:59pm (same submission instructions as HW1).
+No late submission will be accepted.
+
+Need to submit: report.txt, msort.py, inversions.py, and longest.py.
+longest.py will be graded for correctness (1%).
+
+To submit:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw2 report.txt {msort,inversions,longest}.py
+(You can submit each file separately, or submit them together.)
+
+To see your best results so far:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw2
+
+
+Textbooks for References:
+[1] CLRS Ch. 2
+
+0. Which of the following sorting algorithms are (or can be made) stable?
+   (a) mergesort
+   (b) quicksort with the first element as pivot
+   (c) quicksort with randomized pivot
+   (d) selection sort
+   (e) insertion sort
+   (f) heap sort --- not covered yet (see CLRS Ch. 6)
+
+1. Implement mergesort.
+   
+   >>> mergesort([4, 2, 5, 1, 6, 3])
+   [1, 2, 3, 4, 5, 6]   
+   
+   Filename: msort.py
+   
+2. Calculate the number of inversions in a list.
+
+   >>> num_inversions([4, 1, 3, 2])
+   4
+   >>> num_inversions([2, 4, 1, 3])
+   3
+
+   Filename: inversions.py
+   Must run in O(nlogn) time.
+
+3. [WILL BE GRADED] 
+
+   Length of the longest path in a binary tree (number of edges).
+   
+   We will use the "buggy qsort" representation of binary trees from HW1:
+   [left_subtree, root, right_subtree]
+
+   >>> longest([[], 1, []])
+   0
+
+   >>> longest([[[], 1, []], 2, [[], 3, []]])
+   2
+
+   >>> longest([[[[], 1, []], 2, [[], 3, []]], 4, [[[], 5, []], 6, [[], 7, [[], 9, []]]]])
+   5
+
+   Note the answer is 5 because the longest path is 1-2-4-6-7-9.   
+
+   Filename: longest.py
+   Must run in O(n) time.
+
+Debriefing (required!): --------------------------
+
+1. Approximately how many hours did you spend on this assignment?
+2. Would you rate it as easy, moderate, or difficult?
+3. Did you work on it mostly alone, or mostly with other people?
+   Note you are encouraged to discuss with your classmates, 
+   but each students should submit his/her own code.
+4. How deeply do you feel you understand the material it covers (0%–100%)? 
+5. Any other comments?
+
+This section is intended to help us calibrate the homework assignments. 
+Your answers to this section will *not* affect your grade; however, skipping it
+will certainly do.
+

code/cs325-langs/hws/hw3.txt

@@ -0,0 +1,83 @@
+CS 325, Algorithms, Fall 2019
+HW3 - K closest numbers; Two Pointers
+
+Due Monday Oct 14, 11:59pm. (same submission instructions as HW1-2).
+No late submission will be accepted.
+
+Need to submit: report.txt, closest_unsorted.py, closest_sorted.py, xyz.py.
+closest_sorted.py will be graded for correctness (1%).
+
+To submit:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw3 report.txt {closest*,xyz}.py
+(You can submit each file separately, or submit them together.)
+
+To see your best results so far:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw3
+
+
+1. Given an array A of n numbers, a query x, and a number k,
+   find the k numbers in A that are closest (in value) to x.
+   For example:
+
+   find([4,1,3,2,7,4], 5.2, 2)	returns   [4,4]
+   find([4,1,3,2,7,4], 6.5, 3)	returns   [4,7,4]
+   find([5,3,4,1,6,3], 3.5, 2)	returns   [3,4]
+
+
+   Filename: closest_unsorted.py
+   Must run in O(n) time. 
+   The elements in the returned list must be in the original order.
+   In case two numbers are equally close to x, choose the earlier one.
+
+
+2. [WILL BE GRADED]
+   Now what if the input array is sorted? Can you do it faster?
+
+   find([1,2,3,4,4,7], 5.2, 2) returns   [4,4]
+   find([1,2,3,4,4,7], 6.5, 3) returns   [4,4,7]
+
+   Filename: closest_sorted.py
+   Must run in O(logn + k) time.
+   The elements in the returned list must be in the original order.
+
+   Note: in case two numbers are equally close to x, choose the smaller one:
+   find([1,2,3,4,4,6,6], 5, 3) returns   [4,4,6]
+   find([1,2,3,4,4,5,6], 4, 5) returns   [2,3,4,4,5]
+
+   Hint: you can use Python's bisect.bisect for binary search.
+
+
+3. For a given array A of n *distinct* numbers, find all triples (x,y,z) 
+   s.t. x + y = z. (x, y, z are distinct numbers)
+
+   e.g.,
+   
+   find([1, 4, 2, 3, 5]) returns [(1,3,4), (1,2,3), (1,4,5), (2,3,5)]
+
+   Note that:
+   1) no duplicates in the input array
+   2) you can choose any arbitrary order for triples in the returned list.
+
+   Filename: xyz.py
+   Must run in O(n^2) time.
+
+   Hint: you can use any built-in sort in Python.
+
+
+Debriefing (required!): --------------------------
+
+0. What's your name?
+1. Approximately how many hours did you spend on this assignment?
+2. Would you rate it as easy, moderate, or difficult?
+3. Did you work on it mostly alone, or mostly with other people?
+   Note you are encouraged to discuss with your classmates, 
+   but each students should submit his/her own code.
+4. How deeply do you feel you understand the material it covers (0%-100%)? 
+
+5. Which part(s) of the course you like the most so far?
+6. Which part(s) of the course you dislike the most so far?
+
+This section is intended to help us calibrate the homework assignments. 
+Your answers to this section will *not* affect your grade; however, skipping it
+will certainly do.
+

code/cs325-langs/hws/hw4.txt

@@ -0,0 +1,114 @@
+CS 325-001, Algorithms, Fall 2019
+HW4 - Priority Queue and Heaps
+
+Due via the submit program on Monday Oct 21, 11:59pm.
+No late submission will be accepted.
+
+Need to submit: report.txt, nbest.py, kmergesort.py, datastream.py.
+datastream.py will be graded for correctness (1%).
+
+To submit:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw4 report.txt {nbest,kmergesort,datastream}.py
+(You can submit each file separately, or submit them together.)
+
+To see your best results so far:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw4
+
+
+Textbooks for References:
+[1] CLRS Ch. 6
+[2] KT slides for binary heaps (only read the first 20 pages!): 
+    https://www.cs.princeton.edu/~wayne/kleinberg-tardos/pdf/BinomialHeaps.pdf
+[3] Python heapq module 
+
+0. There are two methods for building a heap from an unsorted array:
+   (1) insert each element into the heap  --- O(nlogn) -- heapq.heappush()
+   (2) heapify (top-down)                 --- O(n)     -- heapq.heapify()
+
+   (a) Derive these time complexities.
+   (b) Use a long list of random numbers to show the difference in time. (Hint: random.shuffle or random.sample)
+   (c) What about sorted or reversely-sorted numbers?
+
+1. Given two lists A and B, each with n integers, return
+   a sorted list C that contains the smallest n elements from AxB:
+
+     AxB = { (x, y) | x in A, y in B }
+
+   i.e., AxB is the Cartesian Product of A and B.
+
+   ordering:  (x,y) < (x',y') iff. x+y < x'+y' or (x+y==x'+y' and y<y')
+
+   You need to implement three algorithms and compare:
+
+   (a) enumerate all n^2 pairs, sort, and take top n.
+   (b) enumerate all n^2 pairs, but use qselect from hw1.
+   (c) Dijkstra-style best-first, only enumerate O(n) (at most 2n) pairs.
+       Hint: you can use Python's heapq module for priority queue.
+
+   Q: What are the time complexities of these algorithms? 
+
+   >>> a, b = [4, 1, 5, 3], [2, 6, 3, 4]
+   >>> nbesta(a, b)   # algorithm (a), slowest
+   [(1, 2), (1, 3), (3, 2), (1, 4)]
+   >>> nbestb(a, b)   # algorithm (b), slow
+   [(1, 2), (1, 3), (3, 2), (1, 4)]
+   >>> nbestc(a, b)   # algorithm (c), fast
+   [(1, 2), (1, 3), (3, 2), (1, 4)]
+
+   Filename: nbest.py
+
+2. k-way mergesort (the classical mergesort is a special case where k=2).
+
+   >>> kmergesort([4,1,5,2,6,3,7,0], 3)  # k=3
+   [0,1,2,3,4,5,6,7]
+
+   Q: What is the complexity? Write down the detailed analysis in report.txt.
+
+   Filename: kmergesort.py
+
+3. [WILL BE GRADED]
+   
+   Find the k smallest numbers in a data stream of length n (k<<n),
+   using only O(k) space (the stream itself might be too big to fit in memory).
+
+   >>> ksmallest(4, [10, 2, 9, 3, 7, 8, 11, 5, 7])
+   [2, 3, 5, 7]
+   >>> ksmallest(3, range(1000000, 0, -1))
+   [1, 2, 3]
+
+   Note: 
+   a) it should work with both lists and lazy lists
+   b) the output list should be sorted
+
+   Q: What is your complexity? Write down the detailed analysis in report.txt.
+   
+   Filename: datastream.py
+
+   [UPDATE] The built-in function heapq.nsmallest() is _not_ allowed for this problem.
+   	    The whole point is to implement it yourself. :)
+
+
+4. (optional) Summarize the time complexities of the basic operations (push, pop-min, peak, heapify) for these implementations of priority queue:
+   
+   (a) unsorted array
+   (b) sorted array (highest priority first)
+   (c) reversly sorted array (lowest priority first)
+   (d) linked list
+   (e) binary heap
+
+Debriefing (required!): --------------------------
+
+0. What's your name?
+1. Approximately how many hours did you spend on this assignment?
+2. Would you rate it as easy, moderate, or difficult?
+3. Did you work on it mostly alone, or mostly with other people?
+   Note you are encouraged to discuss with your classmates, 
+   but each students should submit his/her own code.
+4. How deeply do you feel you understand the material it covers (0%-100%)? 
+5. Which part(s) of the course you like the most so far?
+6. Which part(s) of the course you dislike the most so far?
+
+This section is intended to help us calibrate the homework assignments. 
+Your answers to this section will *not* affect your grade; however, skipping it
+will certainly do.
+

code/cs325-langs/hws/hw5.txt

@@ -0,0 +1,130 @@
+CS 532-001, Algorithms, Fall 2019
+HW5 - DP (part 1: simple)
+
+HWs 5-7 are all on DPs.
+
+Due Monday Oct 28, 11:59pm.
+No late submission will be accepted.
+
+Need to submit report.txt, mis.py, bsts.py, bitstrings.py.
+mis.py will be graded for correctness (1%).
+
+To submit:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw5 report.txt {mis,bsts,bitstrings}.py
+(You can submit each file separately, or submit them together.)
+
+To see your best results so far:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw5
+
+
+Textbooks for References:
+[1] CLRS Ch. 15
+[2] KT Ch. 6
+    or Ch. 5 in a previous version:
+    http://cs.furman.edu/~chealy/cs361/kleinbergbook.pdf   
+
+Hint: Among the three coding questions, p3 is the easiest, and p1 is similar to p3.
+      You'll realize that both are very similar to p0 (Fibonacci).
+      p2 is slightly different from these, but still very easy.
+
+0. (Optional) Is Fibonacci REALLY O(n)?
+   Hint: the value of f(n) itself grows exponentially.	    
+
+1. [WILL BE GRADED]
+   Maximum Weighted Independent Set 
+
+   [HINT] independent set is a set where no two numbers are neighbors in the original list.
+   	  see also https://en.wikipedia.org/wiki/Independent_set_(graph_theory)
+
+   input:  a list of numbers (could be negative)
+   output: a pair of the max sum and the list of numbers chosen
+
+   >>> max_wis([7,8,5])
+   (12, [7,5])
+
+   >>> max_wis([-1,8,10])
+   (10, [10])
+
+   >>> max_wis([])
+   (0, [])
+
+   [HINT] if all numbers are negative, the optimal solution is 0,
+          since [] is an independent set according to the definition above.
+
+   >>> max_wis([-5, -1, -4])
+   (0, [])
+
+   Q: What's the complexity?
+   
+   Include both top-down (max_wis()) and bottom-up (max_wis2()) solutions, 
+   and make sure they produce exact same results. 
+   We'll only grade the top-down version.
+
+   Tie-breaking: any best solution is considered correct.
+
+   Filename: mis.py
+
+   [HINT] you can also use the naive O(2^n) exhaustive search method to verify your answer.
+   
+
+2. Number of n-node BSTs
+
+   input: n
+   output: number of n-node BSTs
+
+   >>> bsts(2)
+   2
+   >>> bsts(3)
+   5
+   >>> bsts(5)
+   42
+
+   [HINT] There are two 2-node BSTs:
+      2    1
+     /      \
+    1        2
+   Note that all other 2-node BSTs are *isomorphic* to either one.
+      
+   Qa: What's the complexity of this DP?
+   
+   Qb: What's the name of this famous number series?
+
+   Feel free to use any implementation style.
+   
+   Filename: bsts.py
+
+3. Number of bit strings of length n that has
+
+   1) no two consecutive 0s.
+   2) two consecutive 0s.
+   
+   >>> num_no(3)
+   5
+   >>> num_yes(3)
+   3
+
+   [HINT] There are three 3-bit 0/1-strings that have two consecutive 0s.
+            001  100  000
+          The other five 3-bit 0/1-strings have no two consecutive 0s:
+	    010  011  101  110  111
+
+   Feel free to choose any implementation style.
+
+   Filename: bitstrings.py
+
+   [HINT] Like problem 1, you can also use the O(2^n) exhaustive search method to verify your answer.
+
+
+Debriefing (required!): --------------------------
+
+0. What's your name?
+1. Approximately how many hours did you spend on this assignment?
+2. Would you rate it as easy, moderate, or difficult?
+3. Did you work on it mostly alone, or mostly with other people?
+4. How deeply do you feel you understand the material it covers (0%-100%)? 
+5. Which part(s) of the course you like the most so far?
+6. Which part(s) of the course you dislike the most so far?
+
+This section is intended to help us calibrate the homework assignments. 
+Your answers to this section will *not* affect your grade; however, skipping it
+will certainly do.

code/cs325-langs/hws/hw6.txt

@@ -0,0 +1,114 @@
+CS 325-001, Algorithms, Fall 2019
+HW6 - DP (part 2)
+
+Due on Monday Nov 4, 11:59pm.
+No late submission will be accepted.
+
+Need to submit: report.txt, knapsack_unbounded.py, knapsack_bounded.py.
+knapsack_bounded.py will be graded for correctness (1%).
+
+To submit:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw6 report.txt knapsack*.py
+(You can submit each file separately, or submit them together.)
+
+To see your best results so far:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw6
+
+Textbooks for References:
+[1] KT Ch. 6.4
+    or Ch. 5.3 in a previous version:
+    http://cs.furman.edu/~chealy/cs361/kleinbergbook.pdf   
+[2] KT slides for DP (pages 1-37):
+    https://www.cs.princeton.edu/~wayne/kleinberg-tardos/pdf/06DynamicProgrammingI.pdf
+[3] Wikipedia: Knapsack (unbounded and 0/1)
+[4] CLRS Ch. 15
+
+Please answer time/space complexities for each problem in report.txt.
+
+0. For each of the coding problems below:
+   (a) Describe a greedy solution.
+   (b) Show a counterexample to the greedy solution.
+   (c) Define the DP subproblem 
+   (d) Write the recurrence relations
+   (e) Do not forget base cases
+   (f) Analyze the space and time complexities
+
+1. Unbounded Knapsack
+
+   You have n items, each with weight w_i and value v_i, and each has infinite copies.
+   **All numbers are positive integers.**
+   What's the best value for a bag of W?
+
+   >>> best(3, [(2, 4), (3, 5)])
+   (5, [0, 1])
+
+   the input to the best() function is W and a list of pairs (w_i, v_i).
+   this output means to take 0 copies of item 1 and 1 copy of item 2.
+
+   tie-breaking: *reverse* lexicographical: i.e., [1, 0] is better than [0, 1]:
+   (i.e., take as many copies from the first item as possible, etc.)
+
+   >>> best(3, [(1, 5), (1, 5)])
+   (15, [3, 0])
+
+   >>> best(3, [(1, 2), (1, 5)])
+   (15, [0, 3])
+
+   >>> best(3, [(1, 2), (2, 5)])
+   (7, [1, 1])
+
+   >>> best(58, [(5, 9), (9, 18), (6, 12)])
+   (114, [2, 4, 2])
+
+   >>> best(92, [(8, 9), (9, 10), (10, 12), (5, 6)])
+   (109, [1, 1, 7, 1])
+
+   Q: What are the time and space complexities?
+
+   filename: knapsack_unbounded.py
+
+2. [WILL BE GRADED] 
+   Bounded Knapsack
+
+   You have n items, each with weight w_i and value v_i, and has c_i copies.
+   **All numbers are positive integers.**
+   What's the best value for a bag of W?
+
+   >>> best(3, [(2, 4, 2), (3, 5, 3)])
+   (5, [0, 1])
+
+   the input to the best() function is W and a list of triples (w_i, v_i, c_i).
+
+   tie-breaking: same as in p1:
+
+   >>> best(3, [(1, 5, 2), (1, 5, 3)])
+   (15, [2, 1])
+
+   >>> best(3, [(1, 5, 1), (1, 5, 3)])
+   (15, [1, 2])
+
+   >>> best(20, [(1, 10, 6), (3, 15, 4), (2, 10, 3)])
+   (130, [6, 4, 1])
+
+   >>> best(92, [(1, 6, 6), (6, 15, 7), (8, 9, 8), (2, 4, 7), (2, 20, 2)])
+   (236, [6, 7, 3, 7, 2])
+
+   Q: What are the time and space complexities?
+
+   filename: knapsack_bounded.py
+
+   You are encouraged to come up with a few other testcases yourself to test your code!
+   
+Debriefing (required!): --------------------------
+
+0. What's your name?
+1. Approximately how many hours did you spend on this assignment?
+2. Would you rate it as easy, moderate, or difficult?
+3. Did you work on it mostly alone, or mostly with other people?
+4. How deeply do you feel you understand the material it covers (0%-100%)? 
+5. Which part(s) of the course you like the most so far?
+6. Which part(s) of the course you dislike the most so far?
+
+This section is intended to help us calibrate the homework assignments. 
+Your answers to this section will *not* affect your grade; however, skipping it
+will certainly do.

code/cs325-langs/hws/hw8.txt

@@ -0,0 +1,147 @@
+CS 325-001, Algorithms, Fall 2019
+HW8 - Graphs (part I); DP (part III)
+
+Due on Monday November 18, 11:59pm.
+No late submission will be accepted.
+
+Include in your submission: report.txt, topol.py, viterbi.py.
+viterbi.py will be graded for correctness (1%).
+
+To submit:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/submit hw8 report.txt {topol,viterbi}.py
+(You can submit each file separately, or submit them together.)
+
+To see your best results so far:
+flip $ /nfs/farm/classes/eecs/fall2019/cs325-001/query hw8
+
+Textbooks for References:
+[1] CLRS Ch. 23 (Elementary Graph Algorithms)
+[2] KT Ch. 3 (graphs), or Ch. 2 in this earlier version:
+    http://cs.furman.edu/~chealy/cs361/kleinbergbook.pdf
+[3] KT slides (highly recommend!):
+    https://www.cs.princeton.edu/~wayne/kleinberg-tardos/pdf/03Graphs.pdf
+[4] Jeff Erickson: Ch. 5 (Basic Graph Algorithms):
+    http://jeffe.cs.illinois.edu/teaching/algorithms/book/05-graphs.pdf
+[5] DPV Ch. 3, 4.2, 4.4, 4.7 (Dasgupta, Papadimitriou, Vazirani)
+    https://www.cs.berkeley.edu/~vazirani/algorithms/chap3.pdf (decomposition of graphs)
+    https://www.cs.berkeley.edu/~vazirani/algorithms/chap4.pdf (paths, shortest paths)
+[6] my advanced DP tutorial (up to page 16):
+    http://web.engr.oregonstate.edu/~huanlian/slides/COLING-tutorial-anim.pdf
+
+Please answer non-coding questions in report.txt.
+
+0. For the following graphs, decide whether they are
+   (1) directed or undirected, (2) dense or sparse, and (3) cyclic or acyclic:
+
+   (a) Facebook
+   (b) Twitter
+   (c) a family
+   (d) V=airports, E=direct_flights
+   (e) a mesh
+   (f) V=courses, E=prerequisites
+   (g) a tree
+   (h) V=linux_software_packages, E=dependencies
+   (i) DP subproblems for 0-1 knapsack
+
+   Can you name a very big dense graph?
+
+1. Topological Sort
+   
+   For a given directed graph, output a topological order if it exists.
+   
+   Tie-breaking: ARBITRARY tie-breaking. This will make the code 
+   and time complexity analysis a lot easier. 
+
+   e.g., for the following example:
+
+     0 --> 2 --> 3 --> 5 --> 6
+        /    \   |  /    \
+       /      \  v /      \
+     1         > 4         > 7
+
+   >>> order(8, [(0,2), (1,2), (2,3), (2,4), (3,4), (3,5), (4,5), (5,6), (5,7)])
+   [0, 1, 2, 3, 4, 5, 6, 7]
+
+   Note that order() takes two arguments, n and list_of_edges, 
+   where n specifies that the nodes are named 0..(n-1).
+
+   If we flip the (3,4) edge:
+
+   >>> order(8, [(0,2), (1,2), (2,3), (2,4), (4,3), (3,5), (4,5), (5,6), (5,7)])
+   [0, 1, 2, 4, 3, 5, 6, 7]
+
+   If there is a cycle, return None
+
+   >>> order(4, [(0,1), (1,2), (2,1), (2,3)])
+   None
+
+   Other cases:
+
+   >>> order(5, [(0,1), (1,2), (2,3), (3,4)])
+   [0, 1, 2, 3, 4]
+
+   >>> order(5, [])
+   [0, 1, 2, 3, 4]  # could be any order   
+
+   >>> order(3, [(1,2), (2,1)])
+   None
+
+   >>> order(1, [(0,0)]) # self-loop
+   None
+
+   Tie-breaking: arbitrary (any valid topological order is fine).
+   
+   filename: topol.py 
+
+   questions: 
+   (a) did you realize that bottom-up implementations of DP use (implicit) topological orderings?
+       e.g., what is the topological ordering in your (or my) bottom-up bounded knapsack code?
+   (b) what about top-down implementations? what order do they use to traverse the graph?
+   (c) does that suggest there is a top-down solution for topological sort as well? 
+
+2. [WILL BE GRADED]
+   Viterbi Algorithm For Longest Path in DAG (see DPV 4.7, [2], CLRS problem 15-1)
+   
+   Recall that the Viterbi algorithm has just two steps:
+   a) get a topological order (use problem 1 above)
+   b) follow that order, and do either forward or backward updates
+
+   This algorithm captures all DP problems on DAGs, for example,
+   longest path, shortest path, number of paths, etc.
+
+   In this problem, given a DAG (guaranteed acyclic!), output a pair (l, p) 
+   where l is the length of the longest path (number of edges), and p is the path. (you can think of each edge being unit cost)
+
+   e.g., for the above example:
+
+   >>> longest(8, [(0,2), (1,2), (2,3), (2,4), (3,4), (3,5), (4,5), (5,6), (5,7)])
+   (5, [0, 2, 3, 4, 5, 6])
+
+   >>> longest(8, [(0,2), (1,2), (2,3), (2,4), (4,3), (3,5), (4,5), (5,6), (5,7)])
+   (5, [0, 2, 4, 3, 5, 6]) 
+
+   >>> longest(8, [(0,1), (0,2), (1,2), (2,3), (2,4), (4,3), (3,5), (4,5), (5,6), (5,7), (6,7)])
+   (7, [0, 1, 2, 4, 3, 5, 6, 7])  # unique answer
+
+   Note that longest() takes two arguments, n and list_of_edges, 
+   where n specifies that the nodes are named 0..(n-1).
+
+   Tie-breaking: arbitrary. any longest path is fine.   
+
+   Filename: viterbi.py
+
+   Note: you can use this program to solve MIS, knapsacks, coins, etc.
+
+
+Debriefing (required!): --------------------------
+
+0. What's your name?
+1. Approximately how many hours did you spend on this assignment?
+2. Would you rate it as easy, moderate, or difficult?
+3. Did you work on it mostly alone, or mostly with other people?
+4. How deeply do you feel you understand the material it covers (0%-100%)? 
+5. Any other comments?
+
+This section is intended to help us calibrate the homework assignments. 
+Your answers to this section will *not* affect your grade; however, skipping it
+will certainly do.

code/cs325-langs/hws/hw9.txt

@@ -0,0 +1,166 @@
+CS 325, Algorithms, Fall 2019
+HW9 - Graphs (part 2), DP (part 4)
+
+Due Monday Nov 25, 11:59pm. 
+No late submission will be accepted.
+
+Include in your submission: report.txt, dijkstra.py, nbest.py.
+dijkstra.py will be graded for correctness (1%).
+
+Textbooks for References:
+[1] CLRS Ch. 22 (graph)
+[2] my DP tutorial (up to page 16):
+    http://web.engr.oregonstate.edu/~huanlian/slides/COLING-tutorial-anim.pdf
+[3] DPV Ch. 3, 4.2, 4.4, 4.7, 6 (Dasgupta, Papadimitriou, Vazirani)
+    https://www.cs.berkeley.edu/~vazirani/algorithms/chap3.pdf
+    https://www.cs.berkeley.edu/~vazirani/algorithms/chap4.pdf
+    https://www.cs.berkeley.edu/~vazirani/algorithms/chap6.pdf
+[4] KT Ch. 6 (DP)
+    http://www.aw-bc.com/info/kleinberg/assets/downloads/ch6.pdf
+[5] KT slides: Greedy II (Dijkstra)
+    http://www.cs.princeton.edu/~wayne/kleinberg-tardos/
+
+***Please answer time/space complexities for each problem in report.txt.
+
+1. [WILL BE GRADED]
+   Dijkstra (see CLRS 24.3 and DPV 4.4)
+   
+   Given an undirected graph, find the shortest path from source (node 0)
+   to target (node n-1). 
+   
+   Edge weights are guaranteed to be non-negative, since Dijkstra doesn't work
+   with negative weights, e.g.
+ 
+       3
+   0 ------ 1   
+     \    /
+    2 \  / -2
+       \/
+       2
+   
+   in this example, Dijkstra would return length 2 (path 0-2), 
+   but path 0-1-2 is better (length 1).
+
+   For example (return a pair of shortest-distance and shortest-path):
+   
+       1
+   0 ------ 1   
+     \    /  \
+    5 \  /1   \6
+       \/   2  \
+       2 ------ 3
+            
+   >>> shortest(4, [(0,1,1), (0,2,5), (1,2,1), (2,3,2), (1,3,6)])
+   (4, [0,1,2,3])
+
+   If the target node (n-1) is unreachable from the source (0),
+   return None:
+
+   >>> shortest(5, [(0,1,1), (0,2,5), (1,2,1), (2,3,2), (1,3,6)])
+   None
+
+   Another example:
+
+      1          1
+   0-----1    2-----3
+
+   >>> shortest(4, [(0,1,1), (2,3,1)])
+   None
+
+   Tiebreaking: arbitrary. Any shortest path would do.
+
+   Filename: dijkstra.py
+
+   Hint: please use heapdict from here:
+   https://raw.githubusercontent.com/DanielStutzbach/heapdict/master/heapdict.py
+
+   >>> from heapdict import heapdict
+   >>> h = heapdict()
+   >>> h['a'] = 3
+   >>> h['b'] = 1
+   >>> h.peekitem()
+   ('b', 1)
+   >>> h['a'] = 0
+   >>> h.peekitem()
+   ('a', 0)
+   >>> h.popitem()
+   ('a', 0)
+   >>> len(h)
+   1
+   >>> 'a' in h
+   False
+   >>> 'b' in h 
+   True
+
+   You don't need to submit heapdict.py; we have it in our grader.
+
+
+2. [Redo the nbest question from Midterm, preparing for HW10 part 3]
+
+   Given k pairs of lists A_i and B_i (0 <= i < k), each with n sorted numbers,
+   find the n smallest pairs in all the (k n^2) pairs.
+   We say (x,y) < (x', y') if and only if x+y < x'+y'.
+   Tie-breaking: lexicographical (i.e., prefer smaller x).
+
+   You can base your code on the skeleton from the Midterm:
+
+    from heapq import heappush, heappop
+    def nbest(ABs):    # no need to pass in k or n
+        k = len(ABs)
+        n = len(ABs[0][0])
+        def trypush(i, p, q):  # push pair (A_i,p, B_i,q) if possible
+            A, B = ABs[i] # A_i, B_i
+            if p < n and q < n and ______________________________:
+                heappush(h, (________________, i, p, q, (A[p],B[q])))
+                used.add((i, p, q))
+        h, used = ___________________                 # initialize
+        for i in range(k):  # NEED TO OPTIMIZE
+            trypush(______________)
+        for _ in range(n): 
+            _, i, p, q, pair = ________________
+            yield pair     # return the next pair (in a lazy list)
+            _______________________
+            _______________________
+
+
+    But recall we had two optimizations to speed up the first for-loop (queue initialization):
+
+    (1) using heapify instead of k initial pushes. You need to implement this (very easy).
+
+    (2) using qselect to choose top n out of the k bests. This one is OPTIONAL.
+
+    Analyze the time complexity for the version you implemented.
+ 
+    >>> list(nbest([([1,2,4], [2,3,5]), ([0,2,4], [3,4,5])])) 
+
+    [(0, 3), (1, 2), (0, 4)]
+
+    >>> list(nbest([([-1,2],[1,4]), ([0,2],[3,4]), ([0,1],[4,6]), ([-1,2],[1,5])])) 
+    [(-1, 1), (-1, 1)]
+
+    >>> list(nbest([([5,6,10,14],[3,5,10,14]),([2,7,9,11],[3,8,12,16]),([1,3,8,10],[5,9,10,11]),([1,2,3,5],[3,4,9,10]),([4,5,9,10],[2,4,6,11]),([4,6,10,13],[2,3,5,9]),([3,7,10,12],[1,2,5,10]),([5,9,14,15],[4,8,13,14])]))
+
+    [(1, 3), (3, 1), (1, 4), (2, 3)]
+
+    >>> list(nbest([([1,6,8,13],[5,8,11,12]),([1,2,3,5],[5,9,11,13]),([3,5,7,10],[4,6,7,11]),([1,4,7,8],[4,9,11,15]),([4,8,10,13],[4,6,10,11]),([4,8,12,15],[5,10,11,13]),([2,3,4,8],[4,7,11,15]),([4,5,10,15],[5,6,7,8])]))
+
+    [(1, 4), (1, 5), (1, 5), (2, 4)]
+
+    This problem prepares you for the hardest question in HW10 (part 3).
+
+    Filename: nbest.py
+       
+
+
+Debriefing (required!): --------------------------
+
+0. What's your name?
+1. Approximately how many hours did you spend on this assignment?
+2. Would you rate it as easy, moderate, or difficult?
+3. Did you work on it mostly alone, or mostly with other people?
+4. How deeply do you feel you understand the material it covers (0%-100%)? 
+5. Any other comments?
+
+This section is intended to help us calibrate the homework assignments. 
+Your answers to this section will *not* affect your grade; however, skipping it
+will certainly do.

code/cs325-langs/sols/hw1.lang

@@ -0,0 +1,19 @@
+qselect(xs,k) =
+    ~xs -> {
+        pivot <- xs[0]!
+        left <- xs[#0 <= pivot]
+        right <- xs[#0 > pivot]
+    } ->
+        if k > |left| + 1 then qselect(right, k - |left| - 1)
+        else if k == |left| + 1 then [pivot]
+        else qselect(left, k);
+
+_search(xs, k) =
+    if xs[1] == k then xs
+    else if xs[1] > k then _search(xs[0], k)
+    else _search(xs[2], k);
+
+sorted(xs) = sorted(xs[0]) ++ [xs[1]] ++ sorted(xs[2]);
+search(xs, k) = |_search(xs, k)| != 0;
+insert(xs, k) = _insert(k, _search(xs, k));
+_insert(k, xs) = if |xs| == 0 then xs << [] << k << [] else xs

code/cs325-langs/sols/hw2.lang

@@ -0,0 +1,11 @@
+state 0;
+
+effect {
+    if(SOURCE == R) {
+        STATE = STATE + |LEFT|;
+    }
+}
+
+combine {
+    STATE = STATE + LSTATE + RSTATE;
+}

code/cs325-langs/sols/hw3.lang

@@ -0,0 +1,95 @@
+function qselect(xs, k, c) {
+    if xs == [] {
+        return 0;
+    }
+
+    traverser bisector(list: xs, span: (0,len(xs)));
+    traverser pivot(list: xs, random: true);
+
+    let pivotE = pop!(pivot);
+    let (leftList, rightList) = bisect!(bisector, (x) -> c(x) < c(pivotE));
+    
+    if k > len(leftList) + 1 {
+        return qselect(rightList, k - len(leftList) - 1, c);
+    } elsif k == len(leftList) + 1 {
+        return pivotE;
+    } else {
+        return qselect(leftList, k, c);
+    }
+}
+
+function closestUnsorted(xs, k, n) {
+    let min = qselect(list(xs), k, (x) -> abs(x - n));
+    let out = [];
+    let countEqual = k;
+
+    traverser iter(list: xs, span: (0, len(xs)));
+    while valid!(iter) {
+        if abs(at!(iter)-n) < abs(min-n) {
+            let countEqual = countEqual - 1;
+        }
+        step!(iter);
+    }
+
+    traverser iter(list: xs, span: (0, len(xs)));
+    while valid!(iter) {
+        if abs(at!(iter)-n) == abs(min-n) and countEqual > 0 {
+            let countEqual = countEqual - 1;
+            let out = out + [at!(iter)];
+        } elsif abs(at!(iter)-n) < abs(min-n) {
+            let out = out + [at!(iter)];
+        }
+        step!(iter);
+    }
+
+    return out;
+}
+
+function closestSorted(xs, k, n) {
+    let start = bisect(xs, n);
+    let counter = 0;
+    traverser left(list: xs, span: (0, start), reverse: true);
+    traverser right(list: xs, span: (start, len(xs)));
+
+    while counter != k and canstep!(left) and valid!(right) {
+        if abs(at!(left, 1) - n) < abs(at!(right) - n) {
+            step!(left);
+        } else {
+            step!(right);
+        }
+        let counter = counter + 1;
+    }
+
+    while counter != k and (canstep!(left) or valid!(right)) {
+        if canstep!(left) { step!(left); }
+        else { step!(right); }
+        let counter = counter + 1;
+    }
+
+    return subset!(left, right);
+}
+
+sorted function xyz(xs, k) {
+    traverser x(list: xs, span: (0,len(xs)));
+    let dest = [];
+
+    while valid!(x) {
+        traverser z(list: xs, span: (pos!(x)+2,len(xs)));
+        traverser y(list: xs, span: (pos!(x)+1,pos!(z)));
+
+        while valid!(y) and valid!(z) {
+            if at!(x) + at!(y) == at!(z) {
+                let dest = dest + [(at!(x), at!(y), at!(z))];
+                step!(z);
+            } elsif at!(x) + at!(y) > at!(z) {
+                step!(z);
+            } else {
+                step!(y);
+            }
+        }
+
+        step!(x);
+    }
+
+    return dest;
+}

code/cs325-langs/src/Common.hs

@@ -0,0 +1,15 @@
+module Common where
+import PythonAst
+import PythonGen
+import Text.Parsec
+
+compile :: (String -> String -> Either ParseError p) -> (p -> [PyStmt]) -> String -> IO ()
+compile p t f = do
+    let inputName = f ++ ".lang"
+    let outputName = f ++ ".py"
+    file <- readFile inputName
+    let either = p inputName file
+    case either of
+        Right prog -> writeFile outputName (translate $ t prog)
+        Left e -> print e
+

code/cs325-langs/src/CommonParsing.hs

@@ -0,0 +1,90 @@
+module CommonParsing where
+import Data.Char
+import Data.Functor
+import Text.Parsec
+import Text.Parsec.Char
+import Text.Parsec.Combinator
+
+type Parser a b = Parsec String a b
+
+kw :: String -> Parser a ()
+kw s = try $ string s <* spaces $> ()
+
+kwIf :: Parser a ()
+kwIf = kw "if"
+
+kwThen :: Parser a ()
+kwThen = kw "then"
+
+kwElse :: Parser a ()
+kwElse = kw "else"
+
+kwElsif :: Parser a ()
+kwElsif = kw "elsif"
+
+kwWhile :: Parser a ()
+kwWhile = kw "while"
+
+kwState :: Parser a ()
+kwState = kw "state"
+
+kwEffect :: Parser a ()
+kwEffect = kw "effect"
+
+kwCombine :: Parser a ()
+kwCombine = kw "combine"
+
+kwRand :: Parser a ()
+kwRand = kw "rand"
+
+kwFunction :: Parser a ()
+kwFunction = kw "function"
+
+kwSorted :: Parser a ()
+kwSorted = kw "sorted"
+
+kwLet :: Parser a ()
+kwLet = kw "let"
+
+kwTraverser :: Parser a ()
+kwTraverser = kw "traverser"
+
+kwReturn :: Parser a ()
+kwReturn = kw "return"
+
+op :: String -> op -> Parser a op
+op s o = string s $> o
+
+int :: Parser a Int
+int = read <$> (many1 digit <* spaces)
+
+var :: [String] -> Parser a String
+var reserved =
+    do
+        c <- satisfy $ \c -> isLetter c || c == '_'
+        cs <- many (satisfy isLetter <|> digit) <* spaces
+        let name = c:cs
+        if name `elem` reserved
+        then fail "Can't use reserved keyword as identifier"
+        else return name
+
+list :: Char -> Char -> Char -> Parser a b -> Parser a [b]
+list co cc cd pe = surround co cc $ sepBy pe (char cd >> spaces)
+
+surround :: Char -> Char -> Parser a b -> Parser a b
+surround c1 c2 pe =
+    do
+        char c1 >> spaces
+        e <- pe
+        spaces >> char c2 >> spaces
+        return e
+
+level :: (o -> e -> e -> e) -> Parser a o -> Parser a e -> Parser a e
+level c po pe =
+    do
+        e <- pe <* spaces
+        ops <- many $ try $ (flip . c <$> (po <* spaces) <*> pe) <* spaces
+        return $ foldl (flip ($)) e ops
+
+precedence :: (o -> e -> e -> e) -> Parser a e -> [ Parser a o ] -> Parser a e
+precedence = foldl . flip . level

code/cs325-langs/src/LanguageOne.hs

@@ -0,0 +1,393 @@
+module LanguageOne where
+import qualified PythonAst as Py
+import qualified CommonParsing as P
+import Data.Bifunctor
+import Data.Char
+import Data.Functor
+import qualified Data.Map as Map
+import Data.Maybe
+import qualified Data.Set as Set
+import Text.Parsec
+import Text.Parsec.Char
+import Text.Parsec.Combinator
+import Control.Monad.State
+
+{- Data Types -}
+data PossibleType = List | Any deriving Eq
+
+data SelectorMarker = None | Remove
+
+data Op
+    = Add
+    | Subtract
+    | Multiply
+    | Divide
+    | Insert
+    | Concat
+    | LessThan
+    | LessThanEq
+    | GreaterThan
+    | GreaterThanEq 
+    | Equal
+    | NotEqual
+    | And
+    | Or
+
+data Selector = Selector String Expr
+
+data Expr
+    = Var String
+    | IntLiteral Int
+    | ListLiteral [Expr]
+    | Split Expr [Selector] Expr
+    | IfElse Expr Expr Expr
+    | BinOp Op Expr Expr
+    | FunctionCall Expr [Expr]
+    | LengthOf Expr
+    | Random
+    | Access Expr Expr SelectorMarker
+    | Parameter Int
+
+data Function = Function String [String] Expr
+
+data Prog = Prog [Function]
+
+{- Parser -}
+type Parser = Parsec String (Maybe Int)
+
+parseVar :: Parser String
+parseVar = P.var ["if", "then", "else", "var"]
+
+parseThis :: Parser Expr
+parseThis =
+    do
+        char '&'
+        contextNum <- getState
+        spaces
+        return (Var $ "context_" ++ show contextNum)
+
+parseList :: Parser Expr
+parseList = ListLiteral <$>
+    do
+        char '[' >> spaces
+        es <- sepBy parseExpr (char ',' >> spaces)
+        spaces >> char ']' >> spaces
+        return es
+
+parseSplit :: Parser Expr
+parseSplit =
+    do
+        char '~' >> spaces
+        e <- parseExpr
+        spaces >> string "->"
+        spaces >> char '{'
+        contextNum <- getState
+        putState $ return $ 1 + fromMaybe (-1) contextNum
+        es <- many1 (spaces >> parseSelector)
+        putState contextNum
+        spaces >> char '}' >> spaces >> string "->" >> spaces
+        e' <- parseExpr
+        spaces
+        return $ Split e es e'
+
+parseSelectorMarker :: Parser SelectorMarker
+parseSelectorMarker = (char '!' >> return Remove) <|> return None
+
+parseSelector :: Parser Selector
+parseSelector =
+    do
+        name <- parseVar
+        spaces >> string "<-" >> spaces
+        expr <- parseExpr
+        spaces
+        return $ Selector name expr
+
+parseIfElse :: Parser Expr
+parseIfElse =
+    do
+        P.kwIf >> spaces
+        ec <- parseExpr
+        spaces >> P.kwThen >> spaces
+        et <- parseExpr
+        spaces >> P.kwElse >> spaces
+        ee <- parseExpr
+        spaces
+        return $ IfElse ec et ee
+
+parseLength :: Parser Expr
+parseLength =
+    do
+        char '|' >> spaces
+        e <- parseExpr
+        spaces >> char '|' >> spaces
+        return $ LengthOf e
+
+parseParameter :: Parser Expr
+parseParameter =
+    do
+        char '#'
+        d <- digit
+        spaces
+        return $ Parameter $ read [d]
+
+parseParenthesized :: Parser Expr
+parseParenthesized =
+    do
+        char '(' >> spaces
+        e <- parseExpr
+        spaces >> char ')' >> spaces
+        return e
+
+parseBasicExpr :: Parser Expr
+parseBasicExpr = choice
+    [ IntLiteral <$> P.int
+    , parseThis
+    , parseList
+    , parseSplit
+    , parseLength
+    , parseParameter
+    , parseParenthesized
+    , Var <$> try parseVar
+    , P.kwRand $> Random
+    , parseIfElse
+    ] 
+
+parsePostfix :: Parser (Expr -> Expr)
+parsePostfix = parsePostfixAccess <|> parsePostfixCall
+
+parsePostfixAccess :: Parser (Expr -> Expr)
+parsePostfixAccess =
+    do
+        char '[' >> spaces
+        e <- parseExpr
+        spaces >> char ']' >> spaces
+        marker <- parseSelectorMarker
+        spaces
+        return $ \e' -> Access e' e marker
+
+parsePostfixCall :: Parser (Expr -> Expr)
+parsePostfixCall =
+    do
+        char '(' >> spaces
+        es <- sepBy parseExpr (char ',' >> spaces)
+        char ')' >> spaces
+        return $ flip FunctionCall es
+
+parsePostfixedExpr :: Parser Expr
+parsePostfixedExpr =
+    do
+        eb <- parseBasicExpr
+        spaces
+        ps <- many parsePostfix
+        return $ foldl (flip ($)) eb ps
+
+parseExpr :: Parser Expr
+parseExpr = P.precedence BinOp parsePostfixedExpr
+    [ P.op "*" Multiply, P.op "/" Divide
+    , P.op "+" Add, P.op "-" Subtract
+    , P.op "<<" Insert
+    , P.op "++" Concat
+    , try (P.op "<=" LessThanEq) <|> try (P.op ">=" GreaterThanEq) <|>
+        P.op "<" LessThan <|> P.op ">" GreaterThan <|>
+        P.op "==" Equal <|> P.op "!=" NotEqual
+    , P.op "&&" And <|> P.op "||" Or
+    ]
+
+parseFunction :: Parser Function
+parseFunction =
+    do
+        name <- parseVar
+        spaces >> char '(' >> spaces
+        vs <- sepBy parseVar (char ',' >> spaces)
+        spaces >> char ')' >> spaces >> char '=' >> spaces
+        body <- parseExpr
+        spaces
+        return $ Function name vs body
+
+parseProg :: Parser Prog
+parseProg = Prog <$> sepBy1 parseFunction (char ';' >> spaces)
+
+parse :: SourceName -> String -> Either ParseError Prog
+parse = runParser parseProg Nothing 
+
+{- "Type" checker -}
+mergePossibleType :: PossibleType -> PossibleType -> PossibleType
+mergePossibleType List _ = List
+mergePossibleType _ List = List
+mergePossibleType _ _ = Any
+
+getPossibleType :: String -> Expr -> PossibleType
+getPossibleType s (Var s') = if s == s' then List else Any
+getPossibleType _ (ListLiteral _) = List
+getPossibleType s (Split _ _ e) = getPossibleType s e
+getPossibleType s (IfElse i t e) =
+    foldl1 mergePossibleType $ map (getPossibleType s) [i, t, e]
+getPossibleType _ (BinOp Insert _ _) = List
+getPossibleType _ (BinOp Concat _ _) = List
+getPossibleType _ _ = Any
+
+{- Translator -}
+type Translator = Control.Monad.State.State (Map.Map String [String], Int)
+
+currentTemp :: Translator String
+currentTemp = do
+    t <- gets snd
+    return $ "temp" ++ show t
+
+incrementTemp :: Translator String
+incrementTemp = do
+    modify (second (+1))
+    currentTemp
+
+hasLambda :: Expr -> Bool
+hasLambda (ListLiteral es) = any hasLambda es
+hasLambda (Split e ss r) =
+    hasLambda e || any (\(Selector _ e') -> hasLambda e') ss || hasLambda r
+hasLambda (IfElse i t e) = hasLambda i || hasLambda t || hasLambda e
+hasLambda (BinOp o l r) = hasLambda l || hasLambda r
+hasLambda (FunctionCall e es) = any hasLambda $ e : es
+hasLambda (LengthOf e) = hasLambda e
+hasLambda (Access e _ _) = hasLambda e
+hasLambda Parameter{} = True
+hasLambda _ = False
+
+translate :: Prog -> [Py.PyStmt]
+translate p = fst $ runState (translateProg p) (Map.empty, 0)
+
+translateProg :: Prog -> Translator [Py.PyStmt]
+translateProg (Prog fs) = concat <$> traverse translateFunction fs
+
+translateFunction :: Function -> Translator [Py.PyStmt]
+translateFunction (Function n ps ex) = do
+    let createIf p = Py.BinOp Py.Equal (Py.Var p) (Py.ListLiteral [])
+    let createReturn p = Py.IfElse (createIf p) [Py.Return (Py.Var p)] [] Nothing
+    let fastReturn = [createReturn p | p <- take 1 ps, getPossibleType p ex == List]
+    (ss, e) <- translateExpr ex
+    return $ return $ Py.FunctionDef n ps $ fastReturn ++ ss ++ [Py.Return e]
+
+translateSelector :: Selector -> Translator Py.PyStmt
+translateSelector (Selector n e) =
+    let
+        cacheCheck = Py.NotIn (Py.StrLiteral n) (Py.Var "cache")
+        cacheAccess = Py.Access (Py.Var "cache") [Py.StrLiteral n]
+        cacheSet = Py.Assign (Py.AccessPat (Py.Var "cache") [Py.StrLiteral n])
+        body e' = [ Py.IfElse cacheCheck [cacheSet e'] [] Nothing, Py.Return cacheAccess]
+    in
+        do
+            (ss, e') <- translateExpr e
+            vs <- gets fst
+            let callPrereq p = Py.Standalone $ Py.FunctionCall (Py.Var p) []
+            let prereqs = maybe [] (map callPrereq) $ Map.lookup n vs
+            return $ Py.FunctionDef n [] $ ss ++ prereqs ++ body e'
+
+translateExpr :: Expr -> Translator ([Py.PyStmt], Py.PyExpr)
+translateExpr (Var s) = do
+    vs <- gets fst
+    let sVar = Py.Var s
+    let expr = if Map.member s vs then Py.FunctionCall sVar [] else sVar
+    return ([], expr) 
+translateExpr (IntLiteral i) = return ([], Py.IntLiteral i)
+translateExpr (ListLiteral l) = do
+    tl <- mapM translateExpr l
+    return (concatMap fst tl, Py.ListLiteral $ map snd tl)
+translateExpr (Split e ss e') = do
+    vs <- gets fst
+    let cacheAssign = Py.Assign (Py.VarPat "cache") (Py.DictLiteral [])
+    let cacheStmt = [ cacheAssign | Map.size vs == 0 ]
+    let vnames = map (\(Selector n es) -> n) ss
+    let prereqs = snd $ foldl (\(ds, m) (Selector n es) -> (n:ds, Map.insert n ds m)) ([], Map.empty) ss
+    modify $ first $ Map.union prereqs
+    fs <- mapM translateSelector ss
+    (sts, te) <- translateExpr e'
+    modify $ first $ const vs
+    return (cacheStmt ++ fs ++ sts, te)
+translateExpr (IfElse i t e) = do
+    temp <- incrementTemp
+    let tempPat = Py.VarPat temp
+    (ists, ie) <- translateExpr i
+    (tsts, te) <- translateExpr t
+    (ests, ee) <- translateExpr e
+    let thenSts = tsts ++ [Py.Assign tempPat te]
+    let elseSts = ests ++ [Py.Assign tempPat ee]
+    let newIf = Py.IfElse ie thenSts [] $ Just elseSts
+    return (ists ++ [newIf], Py.Var temp)
+translateExpr (BinOp o l r) = do
+    (lsts, le) <- translateExpr l
+    (rsts, re) <- translateExpr r
+    (opsts, oe) <- translateOp o le re
+    return (lsts ++ rsts ++ opsts, oe)
+translateExpr (FunctionCall f ps) = do
+    (fsts, fe) <- translateExpr f
+    tps <- mapM translateExpr ps
+    return (fsts ++ concatMap fst tps, Py.FunctionCall fe $ map snd tps)
+translateExpr (LengthOf e) =
+    second (Py.FunctionCall (Py.Var "len") . return) <$> translateExpr e
+translateExpr (Access e Random m) = do
+    temp <- incrementTemp
+    (sts, ce) <- translateExpr e
+    let lenExpr = Py.FunctionCall (Py.Var "len") [Py.Var temp]
+    let randExpr = Py.FunctionCall (Py.Var "randint") [ Py.IntLiteral 0,  lenExpr ]
+    return (sts, singleAccess ce randExpr m)
+translateExpr (Access c i m) = do
+    (csts, ce) <- translateExpr c
+    (ists, ie) <- translateExpr i
+    temp <- incrementTemp
+    if hasLambda i
+    then return (csts ++ ists ++ [createFilterLambda temp ie m], Py.FunctionCall (Py.Var temp) [ce])
+    else return (csts ++ ists, singleAccess ce ie m)
+translateExpr (Parameter i) = return $ ([], Py.Var $ "arg" ++ show i)
+translateExpr _ = fail "Invalid expression"
+
+singleAccess :: Py.PyExpr -> Py.PyExpr -> SelectorMarker -> Py.PyExpr
+singleAccess c i None = Py.Access c [i]
+singleAccess c i Remove = Py.FunctionCall (Py.Member c "pop") [i]
+
+createFilterLambda :: String -> Py.PyExpr -> SelectorMarker -> Py.PyStmt
+createFilterLambda s e None = Py.FunctionDef s ["arg"]
+    [ Py.Assign (Py.VarPat "out") (Py.ListLiteral [])
+    , Py.For (Py.VarPat "arg0") (Py.Var "arg")
+        [ Py.IfElse e
+            [ Py.Standalone $ Py.FunctionCall (Py.Member (Py.Var "out") "append")
+                [ Py.Var "arg0" ]
+            ]
+            []
+            Nothing
+        ]
+    , Py.Return $ Py.Var "out"
+    ]
+createFilterLambda s e Remove = Py.FunctionDef s ["arg"]
+    [ Py.Assign (Py.VarPat "i") $ Py.IntLiteral 0
+    , Py.Assign (Py.VarPat "out") (Py.ListLiteral [])
+    , Py.While (Py.BinOp Py.LessThan (Py.Var "i") $ Py.FunctionCall (Py.Var "len") [Py.Var "arg"])
+        [ Py.IfElse e
+            [ Py.Standalone $ Py.FunctionCall (Py.Member (Py.Var "out") "append")
+                [ singleAccess (Py.Var "arg") (Py.Var "i") Remove
+                ]
+            ]
+            []
+            Nothing
+        , Py.Assign (Py.VarPat "i") (Py.BinOp Py.Add (Py.Var "i") (Py.IntLiteral 1))
+        ]
+    , Py.Return $ Py.Var "out"
+    ]
+
+translateOp :: Op -> Py.PyExpr -> Py.PyExpr -> Translator ([Py.PyStmt], Py.PyExpr)
+translateOp Add l r = return ([], Py.BinOp Py.Add l r)
+translateOp Subtract l r = return ([], Py.BinOp Py.Subtract l r)
+translateOp Multiply l r = return ([], Py.BinOp Py.Multiply l r)
+translateOp Divide l r = return ([], Py.BinOp Py.Divide l r)
+translateOp LessThan l r = return ([], Py.BinOp Py.LessThan l r)
+translateOp LessThanEq l r = return ([], Py.BinOp Py.LessThanEq l r)
+translateOp GreaterThan l r = return ([], Py.BinOp Py.GreaterThan l r)
+translateOp GreaterThanEq  l r = return ([], Py.BinOp Py.GreaterThanEq  l r)
+translateOp Equal l r = return ([], Py.BinOp Py.Equal l r)
+translateOp NotEqual l r = return ([], Py.BinOp Py.NotEqual l r)
+translateOp And l r = return ([], Py.BinOp Py.And l r)
+translateOp Or l r = return ([], Py.BinOp Py.Or l r)
+translateOp Concat l r = return ([], Py.BinOp Py.Add l r)
+translateOp Insert l r = do
+    temp <- incrementTemp
+    let assignStmt = Py.Assign (Py.VarPat temp) l
+    let appendFunc = Py.Member (Py.Var temp) "append"
+    let insertStmt = Py.Standalone $ Py.FunctionCall appendFunc [r]
+    return ([assignStmt, insertStmt], Py.Var temp)

code/cs325-langs/src/LanguageThree.hs

@@ -0,0 +1,461 @@
+module LanguageThree where
+import qualified CommonParsing as P
+import qualified PythonAst as Py
+import Control.Monad.State
+import Data.Bifunctor
+import Data.Foldable
+import Data.Functor
+import qualified Data.Map as Map
+import Data.Maybe
+import Text.Parsec hiding (State)
+import Text.Parsec.Char
+import Text.Parsec.Combinator
+
+{- Data Types -}
+data Op
+    = Add
+    | Subtract
+    | Multiply
+    | Divide
+    | LessThan
+    | LessThanEqual
+    | GreaterThan
+    | GreaterThanEqual
+    | Equal
+    | NotEqual
+    | And
+    | Or
+
+data Expr
+    = TraverserCall String [Expr]
+    | FunctionCall String [Expr]
+    | BinOp Op Expr Expr
+    | Lambda [String] Expr
+    | Var String
+    | IntLiteral Int
+    | BoolLiteral Bool
+    | ListLiteral [Expr]
+    | TupleLiteral [Expr]
+
+type Branch = (Expr, [Stmt])
+
+data Stmt
+    = IfElse Branch [Branch] [Stmt]
+    | While Branch
+    | Traverser String [(String, Expr)]
+    | Let Pat Expr
+    | Return Expr
+    | Standalone Expr
+
+data Pat
+    = VarPat String
+    | TuplePat [Pat]
+
+data SortedMarker = Sorted | Unsorted deriving Eq
+
+data Function = Function SortedMarker String [String] [Stmt]
+
+data Prog = Prog [Function]
+
+{- Parser -}
+type Parser = Parsec String ()
+
+parseVar :: Parser String
+parseVar = P.var
+    [ "if", "elif", "else"
+    , "while", "let", "traverser"
+    , "function", "sort"
+    , "true", "false"
+    ]
+
+parseBool :: Parser Bool
+parseBool = (string "true" $> True) <|> (string "false" $> False)
+
+parseList :: Parser Expr
+parseList = ListLiteral <$> P.list '[' ']' ',' parseExpr
+
+parseTupleElems :: Parser [Expr]
+parseTupleElems = P.list '(' ')' ',' parseExpr
+
+parseTuple :: Parser Expr
+parseTuple = do
+    es <- parseTupleElems
+    return $ case es of
+        e:[] -> e
+        _ -> TupleLiteral es
+
+parseLambda :: Parser Expr
+parseLambda = try $ do
+    vs <- P.list '(' ')' ',' parseVar
+    string "->" >> spaces
+    Lambda vs <$> parseExpr
+
+parseCall :: Parser Expr
+parseCall = try $ do
+    v <- parseVar
+    choice
+        [ TraverserCall v <$> (char '!' *> parseTupleElems)
+        , FunctionCall v <$> parseTupleElems
+        ]
+
+parseBasic :: Parser Expr
+parseBasic = choice
+    [ IntLiteral <$> P.int
+    , BoolLiteral <$> parseBool
+    , try parseCall
+    , Var <$> parseVar
+    , parseList
+    , parseLambda
+    , parseTuple
+    ]
+
+parseExpr :: Parser Expr
+parseExpr = P.precedence BinOp parseBasic
+    [ P.op "*" Multiply <|> P.op "/" Divide
+    , P.op "+" Add <|> P.op "-" Subtract
+    , P.op "==" Equal <|> P.op "!=" NotEqual <|>
+        try (P.op "<=" LessThanEqual) <|>  P.op "<" LessThan <|>
+        try (P.op ">=" GreaterThanEqual) <|>  P.op ">" GreaterThan
+    , P.op "and" And
+    , P.op "or" Or
+    ]
+
+parseBlock :: Parser [Stmt]
+parseBlock = char '{' >> spaces >> many parseStmt <* char '}' <* spaces
+
+parseBranch :: Parser Branch
+parseBranch = (,) <$> (parseExpr <* spaces) <*> parseBlock
+
+parseIf :: Parser Stmt
+parseIf = do
+    i <- P.kwIf >> parseBranch
+    els <- many (P.kwElsif >> parseBranch)
+    e <- try (P.kwElse >> parseBlock) <|> return []
+    return $ IfElse i els e
+
+parseWhile :: Parser Stmt
+parseWhile = While <$> (P.kwWhile >> parseBranch)
+
+parseTraverser :: Parser Stmt
+parseTraverser = Traverser
+    <$> (P.kwTraverser *> parseVar)
+    <*> (P.list '(' ')' ',' parseKey) <* char ';' <* spaces
+
+parseKey :: Parser (String, Expr)
+parseKey = (,)
+    <$> (parseVar <* spaces <* char ':' <* spaces)
+    <*> parseExpr
+
+parseLet :: Parser Stmt
+parseLet = Let
+    <$> (P.kwLet >> parsePat <* char '=' <* spaces)
+    <*> parseExpr <* char ';' <* spaces
+
+parseReturn :: Parser Stmt
+parseReturn = Return <$> (P.kwReturn >> parseExpr <* char ';' <* spaces)
+
+parsePat :: Parser Pat
+parsePat = (VarPat <$> parseVar) <|> (TuplePat <$> P.list '(' ')' ',' parsePat)
+
+parseStmt :: Parser Stmt
+parseStmt = choice
+    [ parseTraverser
+    , parseLet
+    , parseIf
+    , parseWhile
+    , parseReturn
+    , Standalone <$> (parseExpr <* char ';' <* spaces)
+    ]
+
+parseFunction :: Parser Function
+parseFunction = Function
+    <$> (P.kwSorted $> Sorted <|> return Unsorted)
+    <*> (P.kwFunction >> parseVar)
+    <*> (P.list '(' ')' ',' parseVar)
+    <*> parseBlock
+
+parseProg :: Parser Prog
+parseProg = Prog <$> many parseFunction
+
+parse :: String -> String -> Either ParseError Prog
+parse = runParser parseProg ()
+
+{- Translation -}
+data TraverserBounds = Range Py.PyExpr Py.PyExpr | Random
+
+data TraverserData = TraverserData
+    { list :: Maybe String
+    , bounds :: Maybe TraverserBounds 
+    , rev :: Bool
+    }
+
+data ValidTraverserData = ValidTraverserData
+    { validList :: String
+    , validBounds ::  TraverserBounds
+    , validRev :: Bool
+    }
+
+type Translator = State (Map.Map String ValidTraverserData, [Py.PyStmt], Int)
+
+getScoped :: Translator (Map.Map String ValidTraverserData)
+getScoped = gets (\(m, _, _) -> m)
+
+setScoped :: Map.Map String ValidTraverserData -> Translator ()
+setScoped m = modify (\(_, ss, i) -> (m, ss, i))
+
+scope :: Translator a -> Translator a
+scope m = do
+    s <- getScoped
+    a <- m
+    setScoped s
+    return a
+
+clearTraverser :: String -> Translator ()
+clearTraverser s = modify (\(m, ss, i) -> (Map.delete s m, ss, i))
+
+putTraverser :: String -> ValidTraverserData -> Translator ()
+putTraverser s vtd = modify (\(m, ss, i) -> (Map.insert s vtd m, ss, i))
+
+getTemp :: Translator String
+getTemp = gets $ \(_, _, i) -> "temp" ++ show i
+
+freshTemp :: Translator String
+freshTemp = modify (second (+1)) >> getTemp
+
+emitStatement :: Py.PyStmt -> Translator ()
+emitStatement = modify . first . (:)
+
+collectStatements :: Translator a -> Translator ([Py.PyStmt], a)
+collectStatements t = do
+    modify (first $ const [])
+    a <- t
+    ss <- gets $ \(_, ss, _) -> ss
+    modify (first $ const [])
+    return (ss, a)
+
+withdrawStatements :: Translator (Py.PyStmt) -> Translator [Py.PyStmt]
+withdrawStatements ts =
+    (\(ss, s) -> ss ++ [s]) <$> (collectStatements ts)
+
+requireTraverser :: String -> Translator ValidTraverserData
+requireTraverser s = gets (\(m, _, _) -> Map.lookup s m) >>= handleMaybe
+    where
+        handleMaybe Nothing = fail "Invalid traverser"
+        handleMaybe (Just vtd) = return vtd
+
+traverserIncrement :: Bool -> Py.PyExpr -> Py.PyExpr -> Py.PyExpr
+traverserIncrement rev by e =
+    Py.BinOp op e (Py.BinOp Py.Multiply by (Py.IntLiteral 1))
+    where op = if rev then Py.Subtract else Py.Add
+
+traverserValid :: Py.PyExpr -> ValidTraverserData -> Py.PyExpr
+traverserValid e vtd =
+    case validBounds vtd of
+        Range f t -> 
+            if validRev vtd
+            then Py.BinOp Py.GreaterThanEq e f
+            else Py.BinOp Py.LessThan e t
+        Random -> Py.BoolLiteral True
+
+traverserStep :: String -> ValidTraverserData -> Py.PyStmt
+traverserStep s vtd =
+    case validBounds vtd of
+        Range _ _ -> Py.Assign (Py.VarPat s) $ Py.BinOp op (Py.Var s) (Py.IntLiteral 1)
+            where op = if validRev vtd then Py.Subtract else Py.Add
+        Random -> traverserRandom s $ validList vtd
+
+traverserRandom :: String -> String -> Py.PyStmt
+traverserRandom s l = 
+    Py.Assign (Py.VarPat s) $ Py.FunctionCall (Py.Var "random.randrange")
+        [Py.FunctionCall (Py.Var "len") [Py.Var l]]
+
+hasVar :: String -> Py.PyPat -> Bool
+hasVar s (Py.VarPat s') = s == s'
+hasVar s (Py.TuplePat ps) = any (hasVar s) ps
+hasVar s _ = False
+
+substituteVariable :: String -> Py.PyExpr -> Py.PyExpr -> Py.PyExpr
+substituteVariable s e (Py.BinOp o l r) =
+    Py.BinOp o (substituteVariable s e l) (substituteVariable s e r)
+substituteVariable s e (Py.ListLiteral es) = 
+    Py.ListLiteral $ map (substituteVariable s e) es
+substituteVariable s e (Py.DictLiteral es) =
+    Py.DictLiteral $
+        map (first (substituteVariable s e) . second (substituteVariable s e)) es
+substituteVariable s e (Py.Lambda ps e') =
+    Py.Lambda ps $ if any (hasVar s) ps then substituteVariable s e e' else e'
+substituteVariable s e (Py.Var s')
+    | s == s' = e
+    | otherwise = Py.Var s'
+substituteVariable s e (Py.TupleLiteral es) =
+    Py.TupleLiteral $ map (substituteVariable s e) es
+substituteVariable s e (Py.FunctionCall e' es) =
+    Py.FunctionCall (substituteVariable s e e') $
+        map (substituteVariable s e) es
+substituteVariable s e (Py.Access e' es) =
+    Py.Access (substituteVariable s e e') $
+        map (substituteVariable s e) es
+substituteVariable s e (Py.Ternary i t e') =
+    Py.Ternary (substituteVariable s e i) (substituteVariable s e t)
+        (substituteVariable s e e')
+substituteVariable s e (Py.Member e' m) =
+    Py.Member (substituteVariable s e e') m
+substituteVariable s e (Py.In e1 e2) =
+    Py.In (substituteVariable s e e1) (substituteVariable s e e2)
+substituteVariable s e (Py.NotIn e1 e2) =
+    Py.NotIn (substituteVariable s e e1) (substituteVariable s e e2)
+substituteVariable s e (Py.Slice f t) =
+    Py.Slice (substituteVariable s e <$> f) (substituteVariable s e <$> t)
+
+translateExpr :: Expr -> Translator Py.PyExpr
+translateExpr (TraverserCall "pop" [Var s]) = do
+    l <- validList <$> requireTraverser s
+    return $ Py.FunctionCall (Py.Member (Py.Var l) "pop") [Py.Var s]
+translateExpr (TraverserCall "pos" [Var s]) = do
+    requireTraverser s
+    return $ Py.Var s
+translateExpr (TraverserCall "at" [Var s]) = do
+    l <- validList <$> requireTraverser s
+    return $ Py.Access (Py.Var l) [Py.Var s]
+translateExpr (TraverserCall "at" [Var s, IntLiteral i]) = do
+    vtd <- requireTraverser s
+    return $ Py.Access (Py.Var $ validList vtd)
+        [traverserIncrement (validRev vtd) (Py.IntLiteral i) (Py.Var s)]
+translateExpr (TraverserCall "step" [Var s]) = do
+    vtd <- requireTraverser s
+    emitStatement $ traverserStep s vtd
+    return $ Py.IntLiteral 0
+translateExpr (TraverserCall "canstep" [Var s]) = do
+    vtd <- requireTraverser s
+    return $
+        traverserValid
+            (traverserIncrement (validRev vtd) (Py.IntLiteral 1) (Py.Var s)) vtd
+translateExpr (TraverserCall "valid" [Var s]) = do
+    vtd <- requireTraverser s
+    return $ traverserValid (Py.Var s) vtd
+translateExpr (TraverserCall "subset" [Var s1, Var s2]) = do
+    l1 <- validList <$> requireTraverser s1
+    l2 <- validList <$> requireTraverser s2
+    if l1 == l2
+    then return $ Py.Access (Py.Var l1) [Py.Slice (Just $ Py.Var s1) (Just $ Py.Var s2)]
+    else fail "Incompatible traversers!"
+translateExpr (TraverserCall "bisect" [Var s, Lambda [x] e]) = do
+    vtd <- requireTraverser s
+    newTemp <- freshTemp
+    lambdaExpr <- translateExpr e
+    let access = Py.Access (Py.Var $ validList vtd) [Py.Var s]
+    let translated = substituteVariable x access lambdaExpr
+    let append s = Py.FunctionCall (Py.Member (Py.Var s) "append") [ access ]
+    let bisectStmt = Py.FunctionDef newTemp []
+         [ Py.Nonlocal [s]
+         , Py.Assign (Py.VarPat "l") (Py.ListLiteral [])
+         , Py.Assign (Py.VarPat "r") (Py.ListLiteral [])
+         , Py.While (traverserValid (Py.Var s) vtd)
+            [ Py.IfElse translated
+                [ Py.Standalone $ append "l" ]
+                []
+                (Just [ Py.Standalone $ append "r" ])
+            , traverserStep s vtd
+            ]
+         , Py.Return $ Py.TupleLiteral [Py.Var "l", Py.Var "r"]
+         ]
+    emitStatement bisectStmt
+    return $ Py.FunctionCall (Py.Var newTemp) []
+translateExpr (TraverserCall _ _) = fail "Invalid traverser operation"
+translateExpr (FunctionCall f ps) = do
+    pes <- mapM translateExpr ps
+    return $ Py.FunctionCall (Py.Var f) pes 
+translateExpr (BinOp o l r) =
+    Py.BinOp (translateOp o) <$> translateExpr l <*> translateExpr r
+translateExpr (Lambda ps e) =
+    Py.Lambda (map Py.VarPat ps) <$> translateExpr e
+translateExpr (Var s) = return $ Py.Var s
+translateExpr (IntLiteral i) = return $ Py.IntLiteral i
+translateExpr (BoolLiteral b) = return $ Py.BoolLiteral b
+translateExpr (ListLiteral es) = Py.ListLiteral <$> mapM translateExpr es
+translateExpr (TupleLiteral es) = Py.TupleLiteral <$> mapM translateExpr es
+
+applyOption :: TraverserData -> (String, Py.PyExpr) -> Maybe TraverserData
+applyOption td ("list", Py.Var s) =
+    return $ td { list = Just s }
+applyOption td ("span", Py.TupleLiteral [f, t]) =
+    return $ td { bounds = Just $ Range f t }
+applyOption td ("random", Py.BoolLiteral True) =
+    return $ td { bounds = Just Random }
+applyOption td ("reverse", Py.BoolLiteral b) =
+    return $ td { rev = b }
+applyOption td _ = Nothing
+
+translateOption :: (String, Expr) -> Translator (String, Py.PyExpr)
+translateOption (s, e) = (,) s <$> translateExpr e
+
+defaultTraverser :: TraverserData
+defaultTraverser =
+    TraverserData { list = Nothing, bounds = Nothing, rev = False }
+
+translateBranch :: Branch -> Translator (Py.PyExpr, [Py.PyStmt])
+translateBranch (e, s) = (,) <$> translateExpr e <*>
+    (concat <$> mapM (withdrawStatements . translateStmt) s)
+
+translateStmt :: Stmt -> Translator Py.PyStmt
+translateStmt (IfElse i els e) = uncurry Py.IfElse
+    <$> (translateBranch i) <*> (mapM translateBranch els) <*> convertElse e
+    where
+        convertElse [] = return Nothing
+        convertElse es = Just . concat <$>
+            mapM (withdrawStatements . translateStmt) es
+translateStmt (While b) = uncurry Py.While <$> translateBranch b
+translateStmt (Traverser s os) =
+    foldlM applyOption defaultTraverser <$> mapM translateOption os >>= saveTraverser 
+    where
+        saveTraverser :: Maybe TraverserData -> Translator Py.PyStmt
+        saveTraverser (Just (td@TraverserData { list = Just l, bounds = Just bs})) =
+            putTraverser s vtd $> translateInitialBounds s vtd
+            where
+                vtd = ValidTraverserData
+                    { validList = l
+                    , validBounds = bs
+                    , validRev = rev td
+                    }
+        saveTraverser Nothing = fail "Invalid traverser (!)"
+translateStmt (Let p e) = Py.Assign <$> translatePat p <*> translateExpr e
+translateStmt (Return e) = Py.Return <$> translateExpr e
+translateStmt (Standalone e) = Py.Standalone <$> translateExpr e
+
+translateInitialBounds :: String -> ValidTraverserData -> Py.PyStmt
+translateInitialBounds s vtd =
+    case (validBounds vtd, validRev vtd) of
+        (Random, _) -> traverserRandom s $ validList vtd
+        (Range l _, False) -> Py.Assign (Py.VarPat s) l
+        (Range _ r, True) -> Py.Assign (Py.VarPat s) r
+
+translatePat :: Pat -> Translator Py.PyPat
+translatePat (VarPat s) = clearTraverser s $> Py.VarPat s
+translatePat (TuplePat ts) = Py.TuplePat <$> mapM translatePat ts
+
+translateOp :: Op -> Py.PyBinOp
+translateOp Add = Py.Add
+translateOp Subtract = Py.Subtract
+translateOp Multiply = Py.Multiply
+translateOp Divide = Py.Divide
+translateOp LessThan = Py.LessThan
+translateOp LessThanEqual = Py.LessThanEq
+translateOp GreaterThan = Py.GreaterThan
+translateOp GreaterThanEqual = Py.GreaterThanEq
+translateOp Equal = Py.Equal
+translateOp NotEqual = Py.NotEqual
+translateOp And = Py.And
+translateOp Or = Py.Or
+
+translateFunction :: Function -> [Py.PyStmt]
+translateFunction (Function m s ps ss) = return $ Py.FunctionDef s ps $
+    [ Py.Standalone $ Py.FunctionCall (Py.Member (Py.Var p) "sort") []
+        | p <- take 1 ps, m == Sorted ] ++ stmts
+    where
+        stmts = concat $ evalState
+            (mapM (withdrawStatements . translateStmt) ss) (Map.empty, [], 0)
+
+translate :: Prog -> [Py.PyStmt]
+translate (Prog fs) =
+    (Py.FromImport "bisect" ["bisect"]) :
+    (Py.Import "random") : concatMap translateFunction fs

code/cs325-langs/src/LanguageTwo.hs

@@ -0,0 +1,198 @@
+module LanguageTwo where
+import qualified PythonAst as Py
+import qualified CommonParsing as P
+import Data.Char
+import Data.Functor
+import Text.Parsec
+import Text.Parsec.Char
+import Text.Parsec.Combinator
+
+{- Data Types -}
+data Op
+    = Add
+    | Subtract
+    | Multiply
+    | Divide
+    | Equal
+    | NotEqual
+    | And
+    | Or
+
+data Expr
+    = IntLiteral Int
+    | BinOp Op Expr Expr
+    | Var String
+    | Length Expr
+
+data Stmt
+    = IfElse Expr Stmt (Maybe Stmt)
+    | Assign String Expr
+    | Block [Stmt]
+
+data Prog = Prog Expr [Stmt] [Stmt]
+
+{- Parser -}
+type Parser = Parsec String ()
+
+parseVar :: Parser String
+parseVar = P.var [ "if", "else", "state", "effect", "combine" ]
+
+parseLength :: Parser Expr
+parseLength = Length <$> P.surround '|' '|' parseExpr
+
+parseParenthesized :: Parser Expr
+parseParenthesized = P.surround '(' ')' parseExpr
+
+parseBasic :: Parser Expr
+parseBasic = choice
+    [ IntLiteral <$> P.int
+    , Var <$> parseVar
+    , parseLength
+    , parseParenthesized
+    ]
+
+
+parseExpr :: Parser Expr
+parseExpr = P.precedence BinOp parseBasic
+    [ P.op "*" Multiply <|> P.op "/" Divide
+    , P.op "+" Add <|> P.op "-" Subtract
+    , P.op "==" Equal <|> P.op "!=" NotEqual
+    , P.op "&&" And
+    , try $ P.op "||" Or
+    ]
+
+parseIf :: Parser Stmt
+parseIf = do
+    P.kwIf >> spaces
+    c <- parseParenthesized
+    t <- parseStmt <* spaces
+    e <- (Just <$> (P.kwElse >> spaces *> parseStmt)) <|> return Nothing
+    return $ IfElse c t e
+
+parseBlockStmts :: Parser [Stmt]
+parseBlockStmts = P.surround '{' '}' (many parseStmt)
+
+parseBlock :: Parser Stmt
+parseBlock = Block <$> parseBlockStmts
+
+parseAssign :: Parser Stmt
+parseAssign = Assign <$>
+    (parseVar <* char '=' <* spaces) <*>
+    parseExpr <* (char ';' >> spaces)
+
+parseStmt :: Parser Stmt
+parseStmt = choice
+    [ parseIf
+    , parseAssign
+    , parseBlock
+    ]
+
+parseProgram :: Parser Prog
+parseProgram = do
+    state <- P.kwState >> spaces *> parseExpr <* char ';' <* spaces
+    effect <- P.kwEffect >> spaces *> parseBlockStmts <* spaces
+    combined <- P.kwCombine >> spaces *> parseBlockStmts <* spaces
+    return $ Prog state effect combined
+
+parse :: String -> String -> Either ParseError Prog
+parse = runParser parseProgram ()
+
+{- Translation -}
+baseFunction :: Py.PyExpr -> [Py.PyStmt] -> [Py.PyStmt] -> Py.PyStmt
+baseFunction s e c = Py.FunctionDef "prog" ["xs"] $
+    [Py.IfElse
+        (Py.BinOp Py.LessThan
+            (Py.FunctionCall (Py.Var "len") [Py.Var "xs"])
+            (Py.IntLiteral 2))
+        [Py.Return $ Py.Tuple [s, Py.Var "xs"]]
+        []
+        Nothing
+    , Py.Assign (Py.VarPat "leng")
+        (Py.BinOp Py.FloorDiv
+            (Py.FunctionCall (Py.Var "len") [Py.Var "xs"]) 
+            (Py.IntLiteral 2))
+    , Py.Assign (Py.VarPat "left")
+        (Py.Access
+            (Py.Var "xs") 
+            [Py.Slice Nothing $ Just (Py.Var "leng")])
+    , Py.Assign (Py.VarPat "right")
+        (Py.Access
+            (Py.Var "xs") 
+            [Py.Slice (Just (Py.Var "leng")) Nothing])
+    , Py.Assign (Py.TuplePat [Py.VarPat "ls", Py.VarPat "left"])
+        (Py.FunctionCall (Py.Var "prog") [Py.Var "left"])
+    , Py.Assign (Py.TuplePat [Py.VarPat "rs", Py.VarPat "right"])
+        (Py.FunctionCall (Py.Var "prog") [Py.Var "right"])
+    , Py.Standalone $
+        Py.FunctionCall (Py.Member (Py.Var "left") "reverse") []
+    , Py.Standalone $
+        Py.FunctionCall (Py.Member (Py.Var "right") "reverse") []
+    , Py.Assign (Py.VarPat "state") s
+    , Py.Assign (Py.VarPat "source") (Py.IntLiteral 0)
+    , Py.Assign (Py.VarPat "total") (Py.ListLiteral [])
+    , Py.While
+        (Py.BinOp Py.And
+            (Py.BinOp Py.NotEqual (Py.Var "left") (Py.ListLiteral []))
+            (Py.BinOp Py.NotEqual (Py.Var "right") (Py.ListLiteral []))) $
+        [ Py.IfElse
+            (Py.BinOp Py.LessThanEq
+                (Py.Access (Py.Var "left") [Py.IntLiteral $ -1])
+                (Py.Access (Py.Var "right") [Py.IntLiteral $ -1]))
+            [ Py.Standalone $
+                Py.FunctionCall (Py.Member (Py.Var "total") "append")
+                    [Py.FunctionCall (Py.Member (Py.Var "left") "pop") []]
+            , Py.Assign (Py.VarPat "source") (Py.IntLiteral 1)
+            ]
+            [] $
+            Just
+            [ Py.Standalone $
+                Py.FunctionCall (Py.Member (Py.Var "total") "append")
+                    [Py.FunctionCall (Py.Member (Py.Var "right") "pop") []]
+            , Py.Assign (Py.VarPat "source") (Py.IntLiteral 2)
+            ]
+        ] ++ e
+    ] ++ c ++
+    [ Py.Standalone $ Py.FunctionCall (Py.Member (Py.Var "left") "reverse") []
+    , Py.Standalone $ Py.FunctionCall (Py.Member (Py.Var "right") "reverse") []
+    , Py.Return $ Py.Tuple
+        [ Py.Var "state"
+        , foldl (Py.BinOp Py.Add) (Py.Var "total") [Py.Var "left", Py.Var "right"]
+        ]
+    ]
+
+translateExpr :: Expr -> Py.PyExpr
+translateExpr (IntLiteral i) = Py.IntLiteral i
+translateExpr (BinOp op l r) =
+    Py.BinOp (translateOp op) (translateExpr l) (translateExpr r)
+translateExpr (Var s)
+    | s == "SOURCE" = Py.Var "source"
+    | s == "LEFT" = Py.Var "left"
+    | s == "RIGHT" = Py.Var "right"
+    | s == "STATE" = Py.Var "state"
+    | s == "LSTATE" = Py.Var "ls"
+    | s == "RSTATE" = Py.Var "rs"
+    | s == "L" = Py.IntLiteral 1
+    | s == "R" = Py.IntLiteral 2
+    | otherwise = Py.Var s
+translateExpr (Length e) = Py.FunctionCall (Py.Var "len") [translateExpr e]
+
+translateOp :: Op -> Py.PyBinOp
+translateOp Add = Py.Add
+translateOp Subtract = Py.Subtract
+translateOp Multiply = Py.Multiply
+translateOp Divide = Py.Divide
+translateOp Equal = Py.Equal
+translateOp NotEqual = Py.NotEqual
+translateOp And = Py.And
+translateOp Or = Py.Or
+
+translateStmt :: Stmt -> [Py.PyStmt]
+translateStmt (IfElse c t e) =
+    [Py.IfElse (translateExpr c) (translateStmt t) [] (translateStmt <$> e)]
+translateStmt (Assign "STATE" e) = [Py.Assign (Py.VarPat "state") (translateExpr e)]
+translateStmt (Assign v e) = [Py.Assign (Py.VarPat v) (translateExpr e)]
+translateStmt (Block s) = concatMap translateStmt s
+
+translate :: Prog -> [Py.PyStmt]
+translate (Prog s e c) =
+    [baseFunction (translateExpr s) (concatMap translateStmt e) (concatMap translateStmt c)]

code/cs325-langs/src/PythonAst.hs

@@ -0,0 +1,52 @@
+module PythonAst where
+
+data PyBinOp
+    = Add
+    | Subtract
+    | Multiply
+    | Divide
+    | FloorDiv
+    | LessThan
+    | LessThanEq
+    | GreaterThan
+    | GreaterThanEq 
+    | Equal
+    | NotEqual
+    | And
+    | Or
+
+data PyExpr
+    = BinOp PyBinOp PyExpr PyExpr
+    | IntLiteral Int
+    | StrLiteral String
+    | BoolLiteral Bool
+    | ListLiteral [PyExpr]
+    | DictLiteral [(PyExpr, PyExpr)]
+    | Lambda [PyPat] PyExpr
+    | Var String
+    | TupleLiteral [PyExpr]
+    | FunctionCall PyExpr [PyExpr]
+    | Access PyExpr [PyExpr]
+    | Ternary PyExpr PyExpr PyExpr
+    | Member PyExpr String
+    | In PyExpr PyExpr
+    | NotIn PyExpr PyExpr
+    | Slice (Maybe PyExpr) (Maybe PyExpr)
+
+data PyPat
+    = VarPat String
+    | IgnorePat
+    | TuplePat [PyPat]
+    | AccessPat PyExpr [PyExpr]
+
+data PyStmt
+    = Assign PyPat PyExpr
+    | IfElse PyExpr [PyStmt] [(PyExpr, [PyStmt])] (Maybe [PyStmt])
+    | While PyExpr [PyStmt]
+    | For PyPat PyExpr [PyStmt]
+    | FunctionDef String [String] [PyStmt]
+    | Return PyExpr
+    | Standalone PyExpr
+    | Import String
+    | FromImport String [String]
+    | Nonlocal [String]

code/cs325-langs/src/PythonGen.hs

@@ -0,0 +1,142 @@
+module PythonGen where
+import PythonAst
+import Data.List
+import Data.Bifunctor
+import Data.Maybe
+
+indent :: String -> String
+indent = ("    " ++)
+
+stmtBlock :: [PyStmt] -> [String]
+stmtBlock = concatMap translateStmt
+
+block :: String -> [String] -> [String]
+block s ss = (s ++ ":") : map indent ss
+
+prefix :: String -> PyExpr -> [PyStmt] -> [String]
+prefix s e sts = block (s ++ " " ++ translateExpr e) $ stmtBlock sts
+
+if_ :: PyExpr -> [PyStmt] -> [String]
+if_ = prefix "if"
+
+elif :: PyExpr -> [PyStmt] -> [String]
+elif = prefix "elif"
+
+else_ :: [PyStmt] -> [String]
+else_ = block "else" . stmtBlock
+
+while :: PyExpr -> [PyStmt] -> [String]
+while = prefix "while"
+
+parenth :: String -> String
+parenth s = "(" ++ s ++ ")"
+
+translateStmt :: PyStmt -> [String]
+translateStmt (Assign p e) = [translatePat p ++ " = " ++ translateExpr e]
+translateStmt (IfElse i t es e) =
+    if_ i t ++ concatMap (uncurry elif) es ++ maybe [] else_ e
+translateStmt (While c t) = while c t
+translateStmt (For x in_ b) = block head body
+    where
+        head = "for " ++ translatePat x ++ " in " ++ translateExpr in_
+        body = stmtBlock b
+translateStmt (FunctionDef s ps b) = block head body
+    where
+        head = "def " ++ s ++ "(" ++ intercalate "," ps ++ ")"
+        body = stmtBlock b
+translateStmt (Return e) = ["return " ++ translateExpr e]
+translateStmt (Standalone e) = [translateExpr e]
+translateStmt (Import s) = ["import " ++ s]
+translateStmt (FromImport s ss) =
+    ["from " ++ s ++ " import " ++ intercalate "," ss]
+translateStmt (Nonlocal vs) = 
+    ["nonlocal " ++ intercalate "," vs]
+
+precedence :: PyBinOp -> Int
+precedence Add = 3
+precedence Subtract = 3
+precedence Multiply = 4
+precedence Divide = 4
+precedence FloorDiv = 4
+precedence LessThan = 2
+precedence LessThanEq = 2
+precedence GreaterThan = 2
+precedence GreaterThanEq = 2
+precedence Equal = 2
+precedence NotEqual = 2
+precedence And = 1
+precedence Or = 0
+
+opString :: PyBinOp -> String
+opString Add = "+"
+opString Subtract = "-"
+opString Multiply = "*"
+opString Divide = "/"
+opString FloorDiv = "//"
+opString LessThan = "<"
+opString LessThanEq = "<="
+opString GreaterThan = ">"
+opString GreaterThanEq = ">="
+opString Equal = "=="
+opString NotEqual = "!="
+opString And = " and "
+opString Or = " or "
+
+translateOp :: PyBinOp -> PyBinOp -> PyExpr -> String
+translateOp o o' =
+    if precedence o > precedence o'
+    then parenth . translateExpr
+    else translateExpr
+
+dictMapping :: PyExpr -> PyExpr -> String
+dictMapping f t = translateExpr f ++ ": " ++ translateExpr t
+
+list :: String -> String -> [PyExpr] -> String
+list o c es = o ++ intercalate ", " (map translateExpr es) ++ c
+
+translateExpr :: PyExpr -> String
+translateExpr (BinOp o l@(BinOp o1 _ _) r@(BinOp o2 _ _)) =
+    translateOp o o1 l ++ opString o ++ translateOp o o2 r
+translateExpr (BinOp o l@(BinOp o1 _ _) r) =
+    translateOp o o1 l ++ opString o ++ translateExpr r
+translateExpr (BinOp o l r@(BinOp o2 _ _)) =
+    translateExpr l ++ opString o ++ translateOp o o2 r
+translateExpr (BinOp o l r) =
+    translateExpr l ++ opString o ++ translateExpr r
+translateExpr (IntLiteral i) = show i
+translateExpr (StrLiteral s) = "\"" ++ s ++ "\""
+translateExpr (BoolLiteral b) = if b then "true" else "false"
+translateExpr (ListLiteral l) = list "[" "]" l
+translateExpr (DictLiteral l) =
+    "{" ++ intercalate ", " (map (uncurry dictMapping) l) ++ "}"
+translateExpr (Lambda ps e) = parenth (head ++ ": " ++ body)
+    where
+        head = "lambda " ++ intercalate ", " (map translatePat ps)
+        body = translateExpr e
+translateExpr (Var s) = s
+translateExpr (TupleLiteral es) = list "(" ")" es
+translateExpr (FunctionCall f ps) = translateExpr f ++ list "(" ")" ps
+translateExpr (Access (Var s) e) = s ++ list "[" "]" e
+translateExpr (Access e@Access{} i) = translateExpr e ++ list "[" "]" i
+translateExpr (Access e i) = "(" ++ translateExpr e ++ ")" ++ list "[" "]" i
+translateExpr (Ternary c t e) =
+    translateExpr t ++ " if " ++ translateExpr c ++ " else " ++ translateExpr e
+translateExpr (Member (Var s) m) = s ++ "." ++ m
+translateExpr (Member e@Member{} m) = translateExpr e ++ "." ++ m
+translateExpr (Member e m) = "(" ++ translateExpr e ++ ")." ++ m
+translateExpr (In m c) =
+    "(" ++ translateExpr m ++ ") in (" ++ translateExpr c ++ ")"
+translateExpr (NotIn m c) =
+    "(" ++ translateExpr m ++ ") not in (" ++ translateExpr c ++ ")"
+translateExpr (Slice l r) =
+    maybe [] (parenth . translateExpr) l ++ ":" ++ maybe [] (parenth . translateExpr) r
+
+translatePat :: PyPat -> String
+translatePat (VarPat s) = s
+translatePat IgnorePat = "_"
+translatePat (TuplePat ps) =
+    "(" ++ intercalate "," (map translatePat ps) ++ ")"
+translatePat (AccessPat e es) = translateExpr (Access e es)
+
+translate :: [PyStmt] -> String
+translate = intercalate "\n" . concatMap translateStmt

code/typesafe-interpreter/TypesafeIntr.idr

@@ -0,0 +1,64 @@
+data ExprType
+  = IntType
+  | BoolType
+  | StringType
+
+repr : ExprType -> Type
+repr IntType = Int
+repr BoolType = Bool
+repr StringType = String
+
+data Op
+  = Add
+  | Subtract
+  | Multiply
+  | Divide
+
+data Expr
+  = IntLit Int
+  | BoolLit Bool
+  | StringLit String
+  | BinOp Op Expr Expr
+
+data SafeExpr : ExprType -> Type where
+  IntLiteral : Int -> SafeExpr IntType
+  BoolLiteral : Bool -> SafeExpr BoolType
+  StringLiteral : String -> SafeExpr StringType
+  BinOperation : (repr a -> repr b -> repr c) -> SafeExpr a -> SafeExpr b -> SafeExpr c
+
+typecheckOp : Op -> (a : ExprType) -> (b : ExprType) -> Either String (c : ExprType ** repr a -> repr b -> repr c) 
+typecheckOp Add IntType IntType = Right (IntType ** (+))
+typecheckOp Subtract IntType IntType = Right (IntType ** (-))
+typecheckOp Multiply IntType IntType = Right (IntType ** (*))
+typecheckOp Divide IntType IntType = Right (IntType ** div)
+typecheckOp _ _ _ = Left "Invalid binary operator application"
+
+typecheck : Expr -> Either String (n : ExprType ** SafeExpr n)
+typecheck (IntLit i) = Right (_ ** IntLiteral i)
+typecheck (BoolLit b) = Right (_ ** BoolLiteral b)
+typecheck (StringLit s) = Right (_ ** StringLiteral s)
+typecheck (BinOp o l r) = do
+  (lt ** le) <- typecheck l
+  (rt ** re) <- typecheck r
+  (ot ** f) <- typecheckOp o lt rt
+  pure (_ ** BinOperation f le re)
+
+eval : SafeExpr t -> repr t
+eval (IntLiteral i) = i
+eval (BoolLiteral b) = b
+eval (StringLiteral s) = s
+eval (BinOperation f l r) = f (eval l) (eval r)
+
+resultStr : {t : ExprType} -> repr t -> String
+resultStr {t=IntType} i = show i
+resultStr {t=BoolType} b = show b
+resultStr {t=StringType} s = show s
+
+tryEval : Expr -> String
+tryEval ex =
+  case typecheck ex of
+    Left err => "Type error: " ++ err
+    Right (t ** e) => resultStr $ eval {t} e
+
+main : IO ()
+main = putStrLn $ tryEval $ BinOp Add (IntLit 6) (BinOp Multiply (IntLit 160) (IntLit 2))

config.toml

@@ -4,4 +4,3 @@ title = "Daniel's Blog"
 theme = "vanilla"
 pygmentsCodeFences = true
 pygmentsStyle = "github"
-googleAnalytics = "UA-145822895-1"

content/_index.md

@@ -2,5 +2,5 @@
 title: Daniel's Blog
 ---
 ## Hello!
-Welcome to my blog. Here, I write abour various subjects, including (but not limited to)
+Welcome to my blog. Here, I write about various subjects, including (but not limited to)
 functional programming, compiler development, programming language theory, and occasionally video games. I hope you find something useful here!

content/blog/00_compiler_intro.md

@@ -40,7 +40,7 @@ Let's go over some preliminary information before we embark on this journey.
 #### The "classic" stages of a compiler
 Let's take a look at the high level overview of what a compiler does.
 Conceptually, the components of a compiler are pretty cleanly separated.
-They are as gollows:
+They are as follows:
 
 1. Tokenizing / lexical analysis
 2. Parsing
@@ -140,3 +140,5 @@ Here are the posts that I've written so far for this series:
 * [Compilation]({{< relref "06_compiler_compilation.md" >}})
 * [Runtime]({{< relref "07_compiler_runtime.md" >}})
 * [LLVM]({{< relref "08_compiler_llvm.md" >}})
+* [Garbage Collection]({{< relref "09_compiler_garbage_collection.md" >}})
+* [Polymorphism]({{< relref "10_compiler_polymorphism.md" >}})